Genome Project - Primer on molecular genetics - 1992 (522926), страница 4
Текст из файла (страница 4)
Physical Mapping Strategies. Top-down physical mapping (a) produces maps with few gaps, but map resolution may notallow location of specific genes. Bottom-up strategies (b) generate extremely detailed maps of small areas but leave many gaps.A combination of both approaches is being used. [Source: Adapted from P. R. Billings et al., “New Techniques for PhysicalMapping of the Human Genome,” The FASEB Journal 5(1), 29 (1991).]16Contig maps: Bottom-up mapping.
The bottom-up approach involves cutting thechromosome into small pieces, each of which is cloned and ordered. The ordered fragments form contiguous DNA blocks (contigs). Currently, the resulting “library” of clonesvaries in size from 10,000 bp to 1 Mb (Fig. 9b). An advantage of this approach is theaccessibility of these stable clones to other researchers. Contig construction can beverified by FISH, which localizes cosmids to specific regions within chromosomal bands.Contig maps thus consist of a linked library of small overlapping clones representing acomplete chromosomal segment.
While useful for finding genes localized to a small area(under 2 Mb), contig maps are difficult to extend over large stretches of a chromosomebecause all regions are not clonable. DNA probe techniques can be used to fill in thegaps, but they are time consuming. Figure 10 is a diagram relating the different types ofmaps.Technological improvements now make possible the cloning of large DNA pieces, usingartificially constructed chromosome vectors that carry human DNA fragments as large as1 Mb. These vectors are maintained in yeast cells as artificial chromosomes (YACs). (Formore explanation, see DNA Amplification.) Before YACs were developed, the largestcloning vectors (cosmids) carried inserts of only 20 to 40 kb.
YAC methodology drasticallyreduces the number of clones to be ordered; many YACs span entire human genes. Amore detailed map of a large YAC insert can be produced by subcloning, a process inwhich fragments of the original insert are cloned into smaller-insert vectors. Becausesome YAC regions are unstable, large-capacity bacterial vectors (i.e., those that canaccommodate large inserts) are also being developed.ORNL-DWG 91M-17369Gene orPolymorphismGENETICMAPRESTRICTIONFRAGMENTSORDEREDLIBRARYSEQUENCEGene orPolymorphismFig.
10. Types of GenomeMaps. At the coarsest resolution,the genetic map measuresrecombination frequency betweenlinked markers (genes or polymorphisms). At the next resolution level, restriction fragmentsof 1 to 2 Mb can be separatedand mapped. Ordered libraries ofcosmids and YACs have insertsizes from 40 to 400 kb. The basesequence is the ultimate physicalmap. Chromosomal mapping (notshown) locates genetic sites inrelation to bands on chromosomes (estimated resolution of5 Mb); new in situ hybridizationtechniques can place loci 100 kbapart. These direct strategieslink the other four mappingapproaches diagramed here.[Source: see Fig. 9.]17Primer onMolecularGeneticsSequencing TechnologiesThe ultimate physical map of the human genome is the complete DNA sequence—thedetermination of all base pairs on each chromosome. The completed map will providebiologists with a Rosetta stone for studying human biology and enable medical researchers to begin to unravel the mechanisms of inherited diseases.
Much effort continues to bespent locating genes; if the full sequence were known, emphasis could shift to determininggene function. The Human Genome Project is creating research tools for 21st-centurybiology, when the goal will be to understand the sequence and functions of the genesresiding therein.Achieving the goals of the Human Genome Project will require substantial improvementsin the rate, efficiency, and reliability of standard sequencing procedures. While technological advances are leading to the automation of standard DNA purification, separation, anddetection steps, efforts are also focusing on the development of entirely new sequencingmethods that may eliminate some of these steps.
Sequencing procedures currentlyinvolve first subcloning DNA fragments from a cosmid or bacteriophage library into specialsequencing vectors that carry shorter pieces of the original cosmid fragments (Fig. 11).The next step is to make the subcloned fragments into sets of nested fragments differingin length by one nucleotide, so that the specific base at the end of each successivefragment is detectable after the fragments have been separated by gel electrophoresis.Current sequencing technologies are discussed later.18ORNL-DWG 91M-17367HUMANCHROMOSOMEAverage 400,000-bpfragment cloned into YACYEAST ARTIFICIAL CHROMOSOME (YAC)Average 40,000-bpfragment cloned into cosmidCOSMIDEcoRIEcoRIBamHIEcoRIBamHIBamHIEcoRIEcoRIBamHIBamHIEcoRIBamHIEcoRIBamHIRESTRICTION MAPAverage 4000-bpfragment cloned intoplasmid or sequencingvectorPLASMIDPARTIAL NUCLEOTIDE SEQUENCE(from human β-globin gene)GGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGG.
. .Fig. 11. Constructing Clones for Sequencing. Cloned DNA molecules must be madeprogressively smaller and the fragments subcloned into new vectors to obtain fragments smallenough for use with current sequencing technology. Sequencing results are compiled to providelonger stretches of sequence across a chromosome. (Source: adapted from David A. Micklos andGreg A. Freyer, DNA Science, A First Course in Recombinant DNA Technology, Burlington, N.C.:Carolina Biological Supply Company, 1990.)19DNA Amplification:Cloning and PolymeraseChain Reaction (PCR)(a)ORNL-DWG 92M-6649Cloning (in vivo DNAamplification)Cloning involves the use of recombinant DNAtechnology to propagate DNA fragments inside aforeign host. The fragments are usually isolatedfrom chromosomes using restriction enzymesand then united with a carrier (a vector).
Following introduction into suitable host cells, the DNAfragments can then be reproduced along with thehost cell DNA. Vectors are DNA moleculesoriginating from viruses, bacteria, and yeastcells. They accommodate various sizes offoreign DNA fragments ranging from 12,000 bpfor bacterial vectors (plasmids and cosmids) to1 Mb for yeast vectors (yeast artificial chromosomes). Bacteria are most often the hosts forthese inserts, but yeast and mammalian cellsare also used (a).Vector DNACut DNAmoleculeswith restrictionenzyme togeneratecomplementarysequences onthe vector andthe fragmentChromosomal DNAFragmentTo Be ClonedJoin vector and chromosomalDNA fragment, usingthe enzyme DNA ligaseRecombinant DNA MoleculeCloning procedures provide unlimited material forexperimental study.
A random (unordered) set ofcloned DNA fragments is called a library.Genomic libraries are sets of overlapping fragments encompassing an entire genome (b). Alsoavailable are chromosome-specific libraries,which consist of fragments derived from sourceDNA enriched for a particular chromosome. (SeeSeparating Chromosomes box.)Introduce into bacteriumRecombinantDNA MoleculeBacterialChromosome(a) Cloning DNA in Plasmids. By fragmenting DNA of anyorigin (human, animal, or plant) and inserting it in the DNA ofrapidly reproducing foreign cells, billions of copies of a singlegene or DNA segment can be produced in a very short time.DNA to be cloned is inserted into a plasmid (a small, selfreplicating circular molecule of DNA) that is separate fromchromosomal DNA.
When the recombinant plasmid is introduced into bacteria, the newly inserted segment will bereplicated along with the rest of the plasmid.20(b) Constructing anOverlapping Clone Library.A collection of clones ofchromosomal DNA, called alibrary, has no obvious orderindicating the original positions of the cloned pieces onthe uncut chromosome.To establish that two particular clones are adjacent toeach other in the genome,libraries of clones containingpartly overlapping regionsmust be constructed.
Theseclone libraries are ordered bydividing the inserts into smallerfragments and determiningwhich clones share commonDNA sequences.(b)ORNL-DWG 92M-6650Restriction Enzyme Cutting SitesChromosomal DNAPartially cut chromosomal DNA with a frequent-cutterrestriction enzyme (controlling the conditions so thatnot all possible sites are cut on every copy of a specificsequence) to generate a series of overlapping fragmentsrepresenting every cutting site in the original sampleOverlappingFragmentsCut vector DNAwith a restrictionenzymeJoin chromosomal fragmentsto vector, using the enzymeDNA ligaseVector DNALibrary ofOverlappingGenomic ClonesChromosomal DNAVector DNA21PCR (in vitro DNA amplification)Described as being to genes what Gutenberg’s printing press was to the written word, PCR can amplify adesired DNA sequence of any origin (virus, bacteria, plant, or human) hundreds of millions of times in amatter of hours, a task that would have required several days with recombinant technology.
PCR is especially valuable because the reaction is highly specific, easily automated, and capable of amplifying minuteamounts of sample. For these reasons, PCR has also had a major impact on clinical medicine, geneticdisease diagnostics, forensic science, and evolutionary biology.PCR is a process based on a specialized polymerase enzyme, which can synthesize a complementarystrand to a given DNA strand in a mixture containing the 4 DNA bases and 2 DNA fragments (primers, eachabout 20 bases long) flanking the target sequence. The mixture is heated to separate the strands of doublestranded DNA containing the target sequence and then cooled to allow (1) the primers to find and bind totheir complementary sequences on the separated strands and (2) the polymerase to extend the primers intonew complementary strands.
Repeated heating and cooling cycles multiply the target DNA exponentially,since each new double strand separates to become two templates for further synthesis. In about 1 hour, 20PCR cycles can amplify the target by a millionfold.DNA Amplification Using PCRReaction mixture contains targetDNA sequence to be amplified,two primers (P1, P2), andheat-stable Taq polymeraseTARGET DNAP1TaqFIRST CYCLEReaction mixture is heatedtp 95°C to denature targetDNA. Subsequent coolingto 37°C allows primers tohybridize to complementarysequences in target DNAP2When heated to 72°C, Taq polymerase extends complementarystrands from primersFirst synthesis cycle resultsin two copies oftarget DNA sequenceDENATUREDNASECOND CYCLEHYBRIDIZEPRIMERSEXTENDNEW DNASTRANDSSecond synthesis cycleresults in four copies oftarget DNA sequenceSource: DNA Science, see Fig.














