Часть 1 (1120999), страница 65
Текст из файла (страница 65)
Written out in the four-letter nucleotide alphabet,the nucleotide sequence of a very small human gene occupies a quarter of apage of text (Figure 4-7), while the complete sequence of nucleotides in thehuman genome would fill more than a thousand books the size of this one. Inaddition to other critical information, it carries the instructions for roughly24,000distinct proteins.At each cell division, the cell must copy its genome to pass it to both daughter cells. The discovery of the structure of DNA also revealed the principle thatmakes this copying possible: because each strand of DNA contains a sequenceof nucleotides that is exactly complementary to the nucleotide sequence of itspartner strand, each strand can act as a template, or mold, for the synthesis of anew complementary strand. In other words, if we designate the two DNAstrands as S and S', strand S can serve as a template for making a new strand S',while strand S' can serve as a template for making a new strand S (Figure 4-8).Thus, the genetic information in DNA can be accurately copied by the beautifully simple process in which strand S separatesfrom strand S', and each separated strand then servesas a template for the production of a new complementary partner strand that is identical to its former partner.The ability of each strand of a DNA molecule to act as a template for producing a complementary strand enables a cell to copy, or replicate,its genomebefore passing it on to its descendants.In the next chapter we shall describe theelegant machinery the cell uses to perform this enormous task.CCCTCTCCAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAGGGAGGGCAGGAGr-Aaaaa4---! \.AgUUUf UU9UAr ffiUI UAUUUUAbAbCCATCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACTCAAACAGACA-i^taifr^iiuunrwrw6LUFFr uAvrLUr u69uAuffibtCTGCCGTTACTGCCCTGTC,CGGCAAGGTGAnugrugArglsuruudgur 1wr\srwl96wuuulls1A!uftuuI IAvlsuALauuITTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGMGACTCTTGCCTTTCTGATACGCACTGACTCTCTCTGCCTATTGGTCTATT TTCCCACCCTTAGGCTCCTGGTGGTCTACtimnaalFFr^vvrfuunvwvn96|WlIUII IUAUIUUII ICGGGATCTGTCCACTCCTGCTGCTGTTATGuuuruLuuffiurrlu\srusuu!l'u9 lluulwvIuuuffigI I tAultsIuuuLluGCTCACCTGGACAACCTCAAGffiACCTTTGCCACACTGAGTGACCTrcACTGTGACMGCTGCACGTCGATCCTGAGAACTTCAGGGTGACTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTMGTTCATCTCATAUUffiUUUUHUSUI &UHUUUt nLAbI 1 1AGAATGGGAAACAGACGAATGATTGC.qTCAGTGTGGAACTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATMCAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTATACTTAAT GCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAGTAACTTAAAAffiUII IAVAIdUIUIUU!IAUIAUAIIACTATTTGGAATATATGTGTGCTTATTTGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTTTTAAI hIUIIn Eucaryotes,DNAls Enclosedin a CellNucleusAs described in Chapter l, nearly all the DNA in a eucaryotic cell is sequesteredin a nucleus, which in many cells occupies about l0% of the total cell volume.This compartment is delimited by a nuclear enuelopeformed by two concentriclipid bilayer membranes (Figure 4-9).
These membranes are punctured at intervals by large nuclear pores, which transport molecules between the nucleus andthe cytosol. The nuclear envelope is directly connected to the extensive membranes of the endoplasmic reticulum, which extend out from it into the cytoplasm. And it is mechanically supported by a network of intermediate filamentscalled the nuclear lamina, which forms a thin sheetlike meshwork just beneaththe inner nuclear membrane (seeFigure 4-98).The nuclear envelope allows the many proteins that act on DNA to be concentrated where they are needed in the cell, and, as we see in subsequentFigure4-7 The nucleotidesequenceof the human p-globingene.Byconvention,a nucleotidesequenceis writtenfrom its 5'end to its3'end, and it shouldbe readfrom left to right in successivelinesdown thepageasthough it werenormalEnglishtext.Thisgenecarriestheinformationfor the aminoacidsequenceof one of the two typesofsubunitsof the hemoglobinmolecule,the proteinthat carriesoxygeninthe blood.A differentgene,the a-globingene,carriesthe informationforthe othertype of hemoglobinsubunit(a hemoglobinmoleculehasfoursubunits,two of eachtype).Onlyone of the two strandsof the DNAdoublehelixcontainingthe B-globingeneis shown;the otherstrandhasthe exactcomplementarysequence.The DNAsequenceshighlightedin yellowshowthe threeregionsof the genethat specifythe aminoacidsequencefor theB-globinprotein.We shallseein Chapter6 how the cellsplicesthesethreesequencestogetherat the levelof messengerRNAin orderto synthesizeafull-lenqthB-qlobinprotein.U I6IA!AIAl1 UHLUffilUAUWlAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGMTMCAGTGATAATTTCTGGGTTAAGGCAATAGCAATAffluru\AfArl l9ruuAtAllsATTCTAACTGATGTAAGAGGTTTCATATTGTACAATCCAGCTACCATCTAATAGCAGCTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTTGTGCT rcCCCATCACTTTCCCAAAGMTTCACCCCACCAGTGCAG@T@CTATCAGAAAGTGGTffi TGGTGTGCCTAATGCCCTC,CCCCACMGTATCACTAAGCTCGCTTTCTTGClulLu&tI LLr6lrffiuulrLuiIIullCCCTAAGTCCAACTACTAAACTGGGGGATATTATCAAGGGCCTTGAGCATCTGGATTCTG!!f M]ffiLhII f dIru^rul6ttrffirhLrrffiuuuMr6lf 1 IUAfIULlgI lulu/fiIhlttlr u r uuuAuuI uAuIULATT T ry\'\i\CAT Ai\,\GAAATGATGAGCTGTTCffiUUl1l&UffiIAUALIAIAII-I 1HCTCCATCAAAGAAGGTGAGGCTGCAACCAGCTAATGCACATTGGCAACAGCCCCTGATGC!] H I l*LI I AIIUAIU!!fUAUffiUUAITCTTGTAGAGGCTTGATTTGCAGGTTAAAGTGTTTTAGCTGTCCTCATGAATGTCTTTTCTHESTRUCTUREAND FUNCTIONOF DNA201t e m p l a t eS s t r a n dFigure4-8 DNA as a template for itsown duplication.As the nucleotideApairsonly with I and G withsuccessfullyC,eachstrandof DNAcan act asatemplateto specifythe sequenceofin its complementarystrand.nucleotidesIn this way,double-helicalDNAcan bewith eachparentalDNAcopiedprecisely,helixproducingtwo identicaldaughterDNAhelices.5 strandnew S'strandnew 5 strandS'strandp a r e n t a lD N A d o u b l e h e l i xt e m o l a t e5 ' s t r a n dd a u g h t e rD N A d o u b l e h e l i c e schapters, it also keeps nuclear and cytosolic enzymes separate,a feature that iscrucial for the proper functioning of eucaryotic cells.
Compartmentalization, ofwhich the nucleus is an example, is an important principle of biology; it servesto establish an environment in which biochemical reactions are facilitated bythe high concentration of both substrates and the enzymes that act on them.Compartmentalization also prevents enzymes needed in one part of the cellfrom interfering with the orderly biochemical pathways in another.Su m m a r yGenetic information is caruied in the linear sequenceof nucleotides in DNA. Eachmolecule of DNA is a double helix formed from two complementery strands ofnucleotidesheld togetherby hydrogen bonds betweenG-C and A-T basepairs. Dultlication of the geneticinformation occursby the useof one DNA strand as a templatefortheformation of a complementarystrand.
Thegeneticinformation storedin an organism's DNA contains the instructionsfor all the proteins the organism will euersynthesize and is said to comprise its genome.In eucaryotes,DNA is contained in the cellnucleus,a largemembrane-boundcompartment.e n d o p l a s m i rce t i c u l u mperipheralheterochromatinDNA and associatedp r o t e i n s( c h r o m a t i n ) ,p l u sm a n y R N Aa n dp r o t e i nm o l e c u l e snucteotuSnucleolusmicrotubulen u c l e a lra m i n a\)n u c l e a rp o r e/(B)z pmmembraneinnernuclearlFigure4-9 A cross-sectionalview of a typicalcell nucleus.(A)Electronmicrographof a thin sectionthroughthe nucleusthe outer(B)Schematicof a humanfibroblast.drawing,showingthat the nuclearenvelopeconsistsof two membranes,one beingcontinuouswith the endoplasmicreticulummembrane(seealsoFigure12-8).The spaceinsidethe endoplasmicThe lipidreticulum(theERlumen)is coloredyel/or4tit is continuouswith the spacebetweenthe two nuclearmembranes.networkofbilayersof the innerand outer nuclearmembranesareconnectedat eachnuclearpore.A sheet-likeforminga specialsupportfor the nuclearenvelope,intermediatefilaments(brown)insidethe nucleusprovidesmechanicalnearthe laminacontainssupportingstructurecalledthe nuclearlamina(fordetails,seeChapter12).The heterochromatinlater.speciallycondensedregionsof DNAthat will be discussed202Chapter4: DNA,Chromosomes,and GenomesCHROMOSOMALDNAAND ITSPACKAGINGINTHECHROMATINFIBERThe most important function of DNA is to carry genes, the information thatspecifies all the proteins and RNA molecules that make up an organismincluding information about when, in what types of cells, and in what quantityeach protein is to be made.
The genomes of eucaryotesare divided up into chromosomes, and in this section we see how genes are typically arranged on eachchromosome. In addition, we describe the specialized DNA sequencesthat arerequired for a chromosome to be accurately duplicated and passedon from onegeneration to the next.We also confront the serious challenge of DNA packaging. If the doublehelices comprising all 46 chromosomes in a human cell could be laid end-toend, they would reach approKimately 2 meters; yet the nucleus, which containsthe DNA, is only about 6 pm in diameter. This is geometrically equivalent topacking 40 km (24 miles) of extremely fine thread into a tennis ball! The complextask of packaging DNA is accomplished by specializedproteins that bind to andfold the DNA, generating a series of coils and loops that provide increasinglyhigher levels of organization, preventing the DNA from becoming an unmanageable tangle.
















