Часть 1 (1120999), страница 6

Файл №1120999 Часть 1 (B. Alberts, A. Johnson, J. Lewis и др. - Molecular Biology of The Cell (5th edition)) 6 страницаЧасть 1 (1120999) страница 62019-05-09СтудИзба
Просмтор этого файла доступен только зарегистрированным пользователям. Но у нас супер быстрая регистрация: достаточно только электронной почты!

Текст из файла (страница 6)

This base-pairing holds fresh monomers in place and therebycontrols the selection of which one of the four monomers shall be added to thegrowing strand next. In this way, a double-stranded structure is created, consisting of two exactly complementary sequences of As, Cs, Ts, and Gs. The twostrands twist around each other, forming a double helix (Figure 1–2E).(A)building block of DNA(D)double-stranded DNAphosphatesugar+sugarphosphate(B)GGACTGGCAATGnucleotideTGACCGTTACbaseDNA strandGTAACGGsugar-phosphatebackboneACT(E)(C)hydrogen-bondedbase pairsDNA double helixtemplated polymerization of new strandnucleotidemonomersCCCAAGGTTAGCGGTTGTTAGGCAAAGCTCACGACCAFigure 1–2 DNA and its building blocks.

(A) DNA is made from simple subunits, called nucleotides, each consisting of a sugar-phosphatemolecule with a nitrogen-containing sidegroup, or base, attached to it. The bases are of four types (adenine, guanine, cytosine, and thymine),corresponding to four distinct nucleotides, labeled A, G, C, and T. (B) A single strand of DNA consists of nucleotides joined together by sugarphosphate linkages. Note that the individual sugar-phosphate units are asymmetric, giving the backbone of the strand a definite directionality,or polarity.

This directionality guides the molecular processes by which the information in DNA is interpreted and copied in cells: theinformation is always “read” in a consistent order, just as written English text is read from left to right. (C) Through templated polymerization,the sequence of nucleotides in an existing DNA strand controls the sequence in which nucleotides are joined together in a new DNA strand;T in one strand pairs with A in the other, and G in one strand with C in the other.

The new strand has a nucleotide sequence complementary tothat of the old strand, and a backbone with opposite directionality: corresponding to the GTAA... of the original strand, it has ...TTAC.(D) A normal DNA molecule consists of two such complementary strands.

The nucleotides within each strand are linked by strong (covalent)chemical bonds; the complementary nucleotides on opposite strands are held together more weakly, by hydrogen bonds. (E) The two strandstwist around each other to form a double helix—a robust structure that can accommodate any sequence of nucleotides without altering itsbasic structure.4Chapter 1: Cells and Genomestemplate strandnew strandFigure 1–3 The copying of geneticinformation by DNA replication.

In thisprocess, the two strands of a DNA doublehelix are pulled apart, and each serves asa template for synthesis of a newcomplementary strand.new strandparent DNA double helixtemplate strandThe bonds between the base pairs are weak compared with the sugar-phosphate links, and this allows the two DNA strands to be pulled apart withoutbreakage of their backbones. Each strand then can serve as a template, in theway just described, for the synthesis of a fresh DNA strand complementary toitself—a fresh copy, that is, of the hereditary information (Figure 1–3).

In different types of cells, this process of DNA replication occurs at different rates, withdifferent controls to start it or stop it, and different auxiliary molecules to help italong. But the basics are universal: DNA is the information store, and templatedpolymerization is the way in which this information is copied throughout theliving world.All Cells Transcribe Portions of Their Hereditary Information intothe Same Intermediary Form (RNA)To carry out its information-bearing function, DNA must do more than copyitself. It must also express its information, by letting it guide the synthesis ofother molecules in the cell.

This also occurs by a mechanism that is the samein all living organisms, leading first and foremost to the production of two otherkey classes of polymers: RNAs and proteins. The process (discussed in detail inChapters 6 and 7) begins with a templated polymerization called transcription,in which segments of the DNA sequence are used as templates for the synthesisof shorter molecules of the closely related polymer ribonucleic acid, or RNA.Later, in the more complex process of translation, many of these RNA moleculesdirect the synthesis of polymers of a radically different chemical class—the proteins (Figure 1–4).In RNA, the backbone is formed of a slightly different sugar from that ofDNA—ribose instead of deoxyribose—and one of the four bases is slightly different—uracil (U) in place of thymine (T); but the other three bases—A, C, andG—are the same, and all four bases pair with their complementary counterpartsin DNA—the A, U, C, and G of RNA with the T, A, G, and C of DNA.

During transcription, RNA monomers are lined up and selected for polymerization on atemplate strand of DNA, just as DNA monomers are selected during replication.The outcome is a polymer molecule whose sequence of nucleotides faithfullyrepresents a part of the cell’s genetic information, even though written in aslightly different alphabet, consisting of RNA monomers instead of DNAmonomers.The same segment of DNA can be used repeatedly to guide the synthesis ofmany identical RNA transcripts. Thus, whereas the cell’s archive of genetic information in the form of DNA is fixed and sacrosanct, the RNA transcripts aremass-produced and disposable (Figure 1–5).

As we shall see, these transcriptsfunction as intermediates in the transfer of genetic information: they mainlyserve as messenger RNA (mRNA) to guide the synthesis of proteins according tothe genetic instructions stored in the DNA.RNA molecules have distinctive structures that can also give them other specialized chemical capabilities. Being single-stranded, their backbone is flexible,so that the polymer chain can bend back on itself to allow one part of theDNA synthesis(replication)DNARNA synthesis(transcription)RNAprotein synthesis(translation)PROTEINamino acidsFigure 1–4 From DNA to protein.Genetic information is read out and putto use through a two-step process.

First,in transcription, segments of the DNAsequence are used to guide the synthesisof molecules of RNA. Then, in translation,the RNA molecules are used to guide thesynthesis of molecules of protein.THE UNIVERSAL FEATURES OF CELLS ON EARTH5RNA MOLECULES AS EXPENDABLEINFORMATION CARRIERSDOUBLE-STRANDED DNA ASINFORMATION ARCHIVETRANSCRIPTIONstrand used as a template todirect RNA synthesismany identicalRNA transcriptsmolecule to form weak bonds with another part of the same molecule. Thisoccurs when segments of the sequence are locally complementary: a ...GGGG...segment, for example, will tend to associate with a ...CCCC...

segment. Thesetypes of internal associations can cause an RNA chain to fold up into a specificshape that is dictated by its sequence (Figure 1–6). The shape of the RNAmolecule, in turn, may enable it to recognize other molecules by binding to themselectively—and even, in certain cases, to catalyze chemical changes in themolecules that are bound. As we see in Chapter 6, a few chemical reactions catalyzed by RNA molecules are crucial for several of the most ancient and fundamental processes in living cells, and it has been suggested that more extensivecatalysis by RNA played a central part in the early evolution of life.Figure 1–5 How genetic information isbroadcast for use inside the cell.

Eachcell contains a fixed set of DNAmolecules—its archive of geneticinformation. A given segment of this DNAguides the synthesis of many identicalRNA transcripts, which serve as workingcopies of the information stored in thearchive. Many different sets of RNAmolecules can be made by transcribingselected parts of a long DNA sequence,allowing each cell to use its informationstore differently.All Cells Use Proteins as CatalystsProtein molecules, like DNA and RNA molecules, are long unbranched polymerchains, formed by stringing together monomeric building blocks drawn from astandard repertoire that is the same for all living cells. Like DNA and RNA, theycarry information in the form of a linear sequence of symbols, in the same wayas a human message written in an alphabetic script.

There are many differentprotein molecules in each cell, and—leaving out the water—they form most ofthe cell’s mass.The monomers of protein, the amino acids, are quite different from those ofDNA and RNA, and there are 20 types, instead of 4. Each amino acid is builtaround the same core structure through which it can be linked in a standard wayto any other amino acid in the set; attached to this core is a side group that giveseach amino acid a distinctive chemical character. Each of the protein molecules,or polypeptides, created by joining amino acids in a particular sequence foldsinto a precise three-dimensional form with reactive sites on its surface (FigureGUAUGCCAGUUAGCCGCAUACAGCUUAAACC UG GG(A)AUCGAAUUUAUGCAUUACGUAAAAUUU(B)Figure 1–6 The conformation of an RNAmolecule. (A) Nucleotide pairingbetween different regions of the sameRNA polymer chain causes the moleculeto adopt a distinctive shape.

(B) Thethree-dimensional structure of an actualRNA molecule, from hepatitis delta virus,that catalyzes RNA strand cleavage. Theblue ribbon represents the sugarphosphate backbone; the bars representbase pairs. (B, based on A.R. FerréD’Amaré, K. Zhou and J.A. Doudna, Nature395:567–574, 1998. With permission fromMacmillan Publishers Ltd.)6Chapter 1: Cells and Genomespolysaccharidechain++catalyticsitelysozymemolecule(B)(A) lysozymeFigure 1–7 How a protein molecule acts as catalyst for a chemical reaction.(A) In a protein molecule the polymer chain folds up to into a specific shapedefined by its amino acid sequence.

A groove in the surface of this particularfolded molecule, the enzyme lysozyme, forms a catalytic site. (B) A polysaccharidemolecule (red)—a polymer chain of sugar monomers—binds to the catalytic siteof lysozyme and is broken apart, as a result of a covalent bond-breaking reactioncatalyzed by the amino acids lining the groove.1–7A).

These amino acid polymers thereby bind with high specificity to othermolecules and act as enzymes to catalyze reactions that make or break covalentbonds. In this way they direct the vast majority of chemical processes in the cell(Figure 1–7B). Proteins have many other functions as well—maintaining structures, generating movements, sensing signals, and so on—each proteinmolecule performing a specific function according to its own genetically specified sequence of amino acids. Proteins, above all, are the molecules that put thecell’s genetic information into action.Thus, polynucleotides specify the amino acid sequences of proteins.

Proteins, in turn, catalyze many chemical reactions, including those by which newDNA molecules are synthesized, and the genetic information in DNA is used tomake both RNA and proteins. This feedback loop is the basis of the autocatalytic,self-reproducing behavior of living organisms (Figure 1–8).All Cells Translate RNA into Protein in the Same WayThe translation of genetic information from the 4-letter alphabet of polynucleotides into the 20-letter alphabet of proteins is a complex process. The rulesof this translation seem in some respects neat and rational, in other respectsstrangely arbitrary, given that they are (with minor exceptions) identical in allliving things.

These arbitrary features, it is thought, reflect frozen accidents inthe early history of life—chance properties of the earliest organisms that werepassed on by heredity and have become so deeply embedded in the constitutionof all living cells that they cannot be changed without disastrous effects.The information in the sequence of a messenger RNA molecule is read out ingroups of three nucleotides at a time: each triplet of nucleotides, or codon, specifies (codes for) a single amino acid in a corresponding protein.

Характеристики

Тип файла
PDF-файл
Размер
78,48 Mb
Тип материала
Предмет
Высшее учебное заведение

Список файлов книги

Свежие статьи
Популярно сейчас
Как Вы думаете, сколько людей до Вас делали точно такое же задание? 99% студентов выполняют точно такие же задания, как и их предшественники год назад. Найдите нужный учебный материал на СтудИзбе!
Ответы на популярные вопросы
Да! Наши авторы собирают и выкладывают те работы, которые сдаются в Вашем учебном заведении ежегодно и уже проверены преподавателями.
Да! У нас любой человек может выложить любую учебную работу и зарабатывать на её продажах! Но каждый учебный материал публикуется только после тщательной проверки администрацией.
Вернём деньги! А если быть более точными, то автору даётся немного времени на исправление, а если не исправит или выйдет время, то вернём деньги в полном объёме!
Да! На равне с готовыми студенческими работами у нас продаются услуги. Цены на услуги видны сразу, то есть Вам нужно только указать параметры и сразу можно оплачивать.
Отзывы студентов
Ставлю 10/10
Все нравится, очень удобный сайт, помогает в учебе. Кроме этого, можно заработать самому, выставляя готовые учебные материалы на продажу здесь. Рейтинги и отзывы на преподавателей очень помогают сориентироваться в начале нового семестра. Спасибо за такую функцию. Ставлю максимальную оценку.
Лучшая платформа для успешной сдачи сессии
Познакомился со СтудИзбой благодаря своему другу, очень нравится интерфейс, количество доступных файлов, цена, в общем, все прекрасно. Даже сам продаю какие-то свои работы.
Студизба ван лав ❤
Очень офигенный сайт для студентов. Много полезных учебных материалов. Пользуюсь студизбой с октября 2021 года. Серьёзных нареканий нет. Хотелось бы, что бы ввели подписочную модель и сделали материалы дешевле 300 рублей в рамках подписки бесплатными.
Отличный сайт
Лично меня всё устраивает - и покупка, и продажа; и цены, и возможность предпросмотра куска файла, и обилие бесплатных файлов (в подборках по авторам, читай, ВУЗам и факультетам). Есть определённые баги, но всё решаемо, да и администраторы реагируют в течение суток.
Маленький отзыв о большом помощнике!
Студизба спасает в те моменты, когда сроки горят, а работ накопилось достаточно. Довольно удобный сайт с простой навигацией и огромным количеством материалов.
Студ. Изба как крупнейший сборник работ для студентов
Тут дофига бывает всего полезного. Печально, что бывают предметы по которым даже одного бесплатного решения нет, но это скорее вопрос к студентам. В остальном всё здорово.
Спасательный островок
Если уже не успеваешь разобраться или застрял на каком-то задание поможет тебе быстро и недорого решить твою проблему.
Всё и так отлично
Всё очень удобно. Особенно круто, что есть система бонусов и можно выводить остатки денег. Очень много качественных бесплатных файлов.
Отзыв о системе "Студизба"
Отличная платформа для распространения работ, востребованных студентами. Хорошо налаженная и качественная работа сайта, огромная база заданий и аудитория.
Отличный помощник
Отличный сайт с кучей полезных файлов, позволяющий найти много методичек / учебников / отзывов о вузах и преподователях.
Отлично помогает студентам в любой момент для решения трудных и незамедлительных задач
Хотелось бы больше конкретной информации о преподавателях. А так в принципе хороший сайт, всегда им пользуюсь и ни разу не было желания прекратить. Хороший сайт для помощи студентам, удобный и приятный интерфейс. Из недостатков можно выделить только отсутствия небольшого количества файлов.
Спасибо за шикарный сайт
Великолепный сайт на котором студент за не большие деньги может найти помощь с дз, проектами курсовыми, лабораторными, а также узнать отзывы на преподавателей и бесплатно скачать пособия.
Популярные преподаватели
Добавляйте материалы
и зарабатывайте!
Продажи идут автоматически
6521
Авторов
на СтудИзбе
302
Средний доход
с одного платного файла
Обучение Подробнее