Главная » Просмотр файлов » 7 Биосинтез белка

7 Биосинтез белка (1160076), страница 16

Файл №1160076 7 Биосинтез белка (Лекции) 16 страница7 Биосинтез белка (1160076) страница 162019-09-19СтудИзба
Просмтор этого файла доступен только зарегистрированным пользователям. Но у нас супер быстрая регистрация: достаточно только электронной почты!

Текст из файла (страница 16)

Polypeptides with these signal sequences are moved intothe lumen of the endoplasmic reticulum as theyare synthesized; there they may be modified andmoved to the Golgi complex, and then sorted andsent to lysosomes, the plasma membrane, or secretory vesicles. Other known targeting signals include carbohydrates (mannose-6-phosphate targets proteins to lysosomes) and three-dimensionalstructural features of the proteins called signalpatches. Some proteins are imported into the cellPart IV Information Pathwaysby receptor-mediated endocytosis. These receptorsare also used by some toxins and viruses to gainentry into cells.Proteins are eventually degraded by specializedproteolytic systems present in all cells.

Defectiveproteins and those slated for rapid turnover aregenerally degraded by an ATP-dependent proteolytic system. In eukaryotes, proteins to be brokendown by this system are first tagged by linkingthem to a highly conserved protein called ubiquitin.GeneralBurbaum, J.J. & Schimmel, P. (1991) Structuralrelationships and the classification of aminoacyltRNA synthetases. J. Biol. Chem. 266, 1696516968.Hill, W.E., Dahlberg, A., Garrett, R.A., Moore,P.B., Schlessinger, D., & Warner, J.R. (1990) TheRibosome: Structure, Function, and Evolution, TheAmerican Society for Microbiology, Washington,DC.Many good articles covering a wide range of topics.Spirin, A.S.

(1986) Ribosome Structure and ProteinBiosynthesis, The Benjamin/Cummings PublishingCompany, Menlo Park, CA.Chapeville, F., Lipmann, F., von Ehrenstein, G.,Weisblum, B., Ray, W.J., Jr., & Benzer, S. (1962)On the role of soluble ribonucleic acid in coding foramino acids.

Proc. Natl. Acad. Sci. USA 48,10861092.Classic experiments providing proof for Crick'sadapter hypothesis and showing that amino acidsare not checked after they are linked to tRNAs.The Genetic CodeBarrell, B.G., Air, G.M., & Hutchison, C.A., III(1976) Overlapping genes in bacteriophage c/>X174.Nature 264, 34-41.Crick, F.H.C. (1966) The genetic code: III.

Sci. Am.215 (October), 55-62.An insightful overview of the genetic code at a timewhen the code words had just been worked out.Clarke, S. (1992) Protein isoprenylation and methylation at carboxyl-terminal cysteine residues.Annu. Rev. Biochem. 61, 355-386.Dahlberg, A.E. (1989) The functional role of ribosomal RNA in protein synthesis. Cell 57, 525-529.Fox, T.D. (1987) Natural variation in the geneticcode. Annu.

Rev. Genet. 21, 67-91.Dintzis, H.M. (1961) Assembly of the peptidechains of hemoglobin. Proc. Natl. Acad. Sci. USA47, 247-261.A classic experiment establishing that proteins areassembled beginning at the amino terminus.Hatfield, D. & Oroszlan, S. (1990) The where,what and how of ribosomal frameshifting inretroviral protein synthesis. Trends Biochem. Sci.15, 186-190.Fersht, A. (1985) Enzyme Structure and Mechanism, W.H. Freeman and Company, New York.See Chapter 13 for a discussion of proofreading inaminoacyl-tRNA synthetases.Nirenberg, M.W.

(1963) The genetic code: II. Sci.Am. 208 (March), 80-94.A description of the original experiments.Gualerzi, CO. & Pon, C.L. (1990) Initiation ofmRNA translation in prokaryotes. Biochemistry29, 5881-5889.Stuart, K. (1991) RNA editing in mitochondrialmRNA of trypanosomatids. Trends Biochem. Sci.16, 68-72.Lake, J.A.

(1981) The ribosome. Sci. Am. 245 (August), 84-97.Weiner, A.M. & Maizels, N. (1990) RNA editing:guided but not templated? Cell 61, 917-920.Maden, B.E.H. (1990) The numerous modified nucleotides in eukaryotic ribosomal RNA. Prog. Nucleic Acid Res. Mol. Biol. 39, 241-303.ProteinMoldave, K. (1985) Eukaryotic protein synthesis.Annu. Rev.

Biochem. 54, 1109-1149.SynthesisBjork, G.R., Ericson, J.U., Gustafsson, C.E.D.,Hagervall, T.G., Jonsson, Y.H., & Wikstrom,P.M. (1987) Transfer RNA modification. Annu. Rev.Biochem. 56, 263-288.Noller, H.F., Hoffarth, V., & Zimniak, L. (1992)Unusual resistance of peptidyl transferase to protein extraction procedures. Science 256,1416-1419.Chapter 26 Protein MetabolismNormanly, J. & Abelson, J. (1989) tRNA identity.Annu. Rev. Biochem.

58, 1029-1049.Rich, A. & Kim, S.H. (1978) The three-dimensional structure of transfer RNA. Sci. Am. 238,(January), 52-62.Riis, B., Rattan, S.I.S., Clark, B.F.C., & Merrick,W.C. (1990) Eukaryotic protein elongation factors.Trends Biochem. Sci.

15, 420-424.Schimmel, P. (1989) Parameters for the molecularrecognition of transfer RNAs. Biochemistry 28,2747-2759.Protein Targeting and SecretionBachmair, A., Finley, D., & Varshavsky, A. (1986)In vivo half-life of a protein is a function of itsamino-terminal residue. Science 234, 179-186.Balch, W.E. (1989) Biochemistry of interorganelletransport: a new frontier in enzymology emergesfrom versatile in vitro model systems.

J. Biol.Chem. 264, 16965-16968.Dahms, N.M., Lobel, P., & Kornfeld, S. (1989)Mannose 6-phosphate receptors and lysosomalenzyme targeting. J. Biol. Chem. 264,12115-12118.Goldstein, J.L., Brown, M.S., Anderson, R.G.W.,Russell, D.W., & Schneider, W.J. (1985) Receptormediated endocytosis: concepts emerging from theLDL receptor system. Annu.

Rev. Cell Biol. 1,1-39.Hershko, A. & Ciechanover, A. (1992) The ubiquitin system for protein degradation. Annu. Rev.Biochem. 61, 761-807.Hurt, E.C. & van Loon, A.P.G.M. (1986) How proteins find mitochondria and intramitochondrialcompartments.

Trends Biochem. Sci. 11, 204-207.939Mellman, I., Fuchs, R., & Helenius, A. (1986)Acidification of the endocytic and exocytic pathways. Annu. Rev. Biochem. 55, 663-700.Meyer, D.I. (1988) Preprotein conformation: theyear's major theme in translocation studies.Trends Biochem. Sci. 13, 471-474.Pfeffer, S.R. & Rothman, J.E. (1987) Biosyntheticprotein transport and sorting by the endoplasmicreticulum and Golgi. Annu.

Rev. Biochem. 56, 829852.Pryer, N.K., Wuestehube, L.J. & Schekman, R.(1992) Vesicle-mediated protein sorting. Annu.Rev. Biochem. 61, 471-516.Randall, L.L. & Hardy, S.J.S. (1984) Export ofprotein in bacteria. Microbwl. Rev. 48, 290-298.Rapoport, T.A. (1990) Protein transport across theER membrane. Trends Biochem. Sci. 15, 355-358.Rothman, J.E. (1985) The compartmental organization of the Golgi apparatus. Sci. Am. 253 (September), 74-89.Schmidt, G.W.

& Mishkind, M.L. (1986) Thetransport of proteins into chloroplasts. Annu. Rev.Biochem. 55, 879-912.Silver, P.A. (1991) How proteins enter the nucleus.Cell 64, 489-497.Ward, W.H.J. (1987) Diphtheria toxin: a novel cytocidal enzyme. Trends Biochem. Sci. 12, 28-31.Wickner, W.T. & Lodish, H.F. (1985) Multiplemechanisms of protein insertion into and acrossmembranes. Science 230, 400-407.Problems1. Messenger RNA Translation Predict the aminoacid sequences of peptides formed by ribosomes inresponse to the following mRNAs, assuming thatthe initial codon is the first three bases in eachsequence.(a) GGUCAGUCGCUCCUGAUU(b) UUGGAUGCGCCAUAAUUUGCU(c) CAUGAUGCCUGUUGCUAC(d) AUGGACGAA2.

How Many mRNAs Can Specify One Amino AcidSequence? Write all the possible mRNA sequencesthat can code for the simple tripeptide segmentLeu-Met-Tyr. Your answer will give you someidea as to the number of possible mRNAs that cancode for one polypeptide.3. Can the Base Sequence of an mRNA Be Predicted from the Amino Acid Sequences of Its Polypeptide Product? A given sequence of bases in anmRNA will code for one and only one sequence ofamino acids in a polypeptide, if the reading frameis specified. From a given sequence of amino acidresidues in a protein such as cytochrome c, can wepredict the base sequence of the unique mRNAthat coded for it? Give reasons for your answer.Part IV Information Pathways4.

Coding of a Polypeptide by Duplex DNA Thetemplate strand of a sample of double-helical DNAcontains the sequence(5)CTTAACACCCCTGACTTCGCGCCGTCG(a) What is the base sequence of mRNA that canbe transcribed from this strand?(b) What amino acid sequence could be coded bythe mRNA base sequence in (a), starting from the5' end?(c) Suppose the other (nontemplate) strand ofthis DNA sample is transcribed and translated.Will the resulting amino acid sequence be the sameas in (b)? Explain the biological significance of youranswer.5.

Methionine Has Only One Codon Methionine isone of the two amino acids having only one codon.Yet the single codon for methionine can specifyboth the initiating residue and interior Met residues of polypeptides synthesized by E. coli. Explain exactly how this is possible.6. Synthetic mRNAs How would you make a polyribonucleotide that could serve as an mRNA codingpredominantly for many Phe residues and a smallnumber of Leu and Ser residues? What otheramino acid(s) would be coded for by this polyribonucleotide but in smaller amounts?7.

The Direct Energy Cost of Protein BiosynthesisDetermine the minimum energy cost, in terms ofhigh-energy phosphate groups expended, requiredfor the biosynthesis of the /3-globin chain of hemoglobin (146 residues), starting from a pool including all necessary amino acids, ATP, and GTP. Compare your answer with the direct energy cost of thebiosynthesis of a linear glycogen chain of 146 glucose residues in (al—»4) linkage, starting from apool including glucose, UTP, and ATP (Chapter 19).From your data, what is the extra energy cost ofimparting the genetic information inherent in the/3-globin molecule?8. Indirect Costs of Protein Synthesis In additionto the direct energy cost for the synthesis of a protein, as developed in Problem 7, there are indirectenergy costs—those required for the cell to makethe necessary biocatalysts for protein synthesis.Contrast the relative magnitude of the indirectcosts to a eukaryotic cell of the biosynthesis of linear (al—>4) glycogen chains versus the indirectcosts of the biosynthesis of polypeptides.

Характеристики

Тип файла
PDF-файл
Размер
23,99 Mb
Материал
Тип материала
Высшее учебное заведение

Список файлов лекций

Свежие статьи
Популярно сейчас
Как Вы думаете, сколько людей до Вас делали точно такое же задание? 99% студентов выполняют точно такие же задания, как и их предшественники год назад. Найдите нужный учебный материал на СтудИзбе!
Ответы на популярные вопросы
Да! Наши авторы собирают и выкладывают те работы, которые сдаются в Вашем учебном заведении ежегодно и уже проверены преподавателями.
Да! У нас любой человек может выложить любую учебную работу и зарабатывать на её продажах! Но каждый учебный материал публикуется только после тщательной проверки администрацией.
Вернём деньги! А если быть более точными, то автору даётся немного времени на исправление, а если не исправит или выйдет время, то вернём деньги в полном объёме!
Да! На равне с готовыми студенческими работами у нас продаются услуги. Цены на услуги видны сразу, то есть Вам нужно только указать параметры и сразу можно оплачивать.
Отзывы студентов
Ставлю 10/10
Все нравится, очень удобный сайт, помогает в учебе. Кроме этого, можно заработать самому, выставляя готовые учебные материалы на продажу здесь. Рейтинги и отзывы на преподавателей очень помогают сориентироваться в начале нового семестра. Спасибо за такую функцию. Ставлю максимальную оценку.
Лучшая платформа для успешной сдачи сессии
Познакомился со СтудИзбой благодаря своему другу, очень нравится интерфейс, количество доступных файлов, цена, в общем, все прекрасно. Даже сам продаю какие-то свои работы.
Студизба ван лав ❤
Очень офигенный сайт для студентов. Много полезных учебных материалов. Пользуюсь студизбой с октября 2021 года. Серьёзных нареканий нет. Хотелось бы, что бы ввели подписочную модель и сделали материалы дешевле 300 рублей в рамках подписки бесплатными.
Отличный сайт
Лично меня всё устраивает - и покупка, и продажа; и цены, и возможность предпросмотра куска файла, и обилие бесплатных файлов (в подборках по авторам, читай, ВУЗам и факультетам). Есть определённые баги, но всё решаемо, да и администраторы реагируют в течение суток.
Маленький отзыв о большом помощнике!
Студизба спасает в те моменты, когда сроки горят, а работ накопилось достаточно. Довольно удобный сайт с простой навигацией и огромным количеством материалов.
Студ. Изба как крупнейший сборник работ для студентов
Тут дофига бывает всего полезного. Печально, что бывают предметы по которым даже одного бесплатного решения нет, но это скорее вопрос к студентам. В остальном всё здорово.
Спасательный островок
Если уже не успеваешь разобраться или застрял на каком-то задание поможет тебе быстро и недорого решить твою проблему.
Всё и так отлично
Всё очень удобно. Особенно круто, что есть система бонусов и можно выводить остатки денег. Очень много качественных бесплатных файлов.
Отзыв о системе "Студизба"
Отличная платформа для распространения работ, востребованных студентами. Хорошо налаженная и качественная работа сайта, огромная база заданий и аудитория.
Отличный помощник
Отличный сайт с кучей полезных файлов, позволяющий найти много методичек / учебников / отзывов о вузах и преподователях.
Отлично помогает студентам в любой момент для решения трудных и незамедлительных задач
Хотелось бы больше конкретной информации о преподавателях. А так в принципе хороший сайт, всегда им пользуюсь и ни разу не было желания прекратить. Хороший сайт для помощи студентам, удобный и приятный интерфейс. Из недостатков можно выделить только отсутствия небольшого количества файлов.
Спасибо за шикарный сайт
Великолепный сайт на котором студент за не большие деньги может найти помощь с дз, проектами курсовыми, лабораторными, а также узнать отзывы на преподавателей и бесплатно скачать пособия.
Популярные преподаватели
Добавляйте материалы
и зарабатывайте!
Продажи идут автоматически
7173
Авторов
на СтудИзбе
251
Средний доход
с одного платного файла
Обучение Подробнее