Главная » Просмотр файлов » 6 Биосинтез нуклеиновых кислот

6 Биосинтез нуклеиновых кислот (1160075), страница 14

Файл №1160075 6 Биосинтез нуклеиновых кислот (Лекции) 14 страница6 Биосинтез нуклеиновых кислот (1160075) страница 142019-09-19СтудИзба
Просмтор этого файла доступен только зарегистрированным пользователям. Но у нас супер быстрая регистрация: достаточно только электронной почты!

Текст из файла (страница 14)

26-12). Its promoter varies greatly insequence from one species to another. RNA polymerase II (Pol II) hasthe central function of synthesizing mRNAs, as well as some specialfunction RNAs. This enzyme must recognize thousands of promoters,many of which share some key sequence similarities in most eukaryotes (Fig. 25-7). These sequences are generally binding sites for proteins called transcription factors, which modulate the binding ofRNA polymerase to the promoter. RNA polymerase III (Pol III) makestRNAs, the 5S rRNA, and some other small specialized RNAs. Thepromoter recognized by RNA polymerase III is well characterized.

Interestingly, some of the sequences required for the regulated initiationof transcription by RNA polymerase III are located within the geneitself, whereas others are found in more conventional locations beforethe RNA start site (Chapter 27).Specific Sequences Signal Termination of RNA SynthesisRNA synthesis proceeds until the RNA polymerase encounters a sequence that triggers its dissociation.

This process is not well understood in eukaryotes, and our focus again shifts to bacteria. In E. colithere are at least two classes of such termination signals or terminators. One class relies on a protein factor called p (rho), and the other isp-independent.The p-independent class has two distinguishing features (Fig.25-8). The first is a region that is transcribed into self-complementarysequences, permitting the formation of a hairpin structure (see Fig.12-21) centered 15 to 20 nucleotides before the end of the RNA. Thesecond feature is a run of adenylates in the template strand that aretranscribed into uridylates at the end of the RNA.

It is thought thatformation of the hairpin disrupts part of the RNA-DNA hybrid in thetranscription complex. The remaining hybrid duplex (oligoribo-Uoligodeoxy-A) contains a particularly unstable combination of bases,and the entire complex simply dissociates.The p-dependent terminators lack the sequence of repeated adenylates in the template but do usually have a short sequence that istranscribed to form a hairpin. RNA polymerase pauses at these sequences, and dissociates if p protein is present. The p protein has anATP-dependent RNA-DNA helicase activity and probably disrupts theRNA-DNA hybrid formed during transcription.

ATP is hydrolyzed by pprotein during the termination process, but the detailed mechanism bywhich the protein acts is not known.DNA-Directed RNA Polymerase Can Be Selectively InhibitedThe elongation of RNA chains by RNA polymerase in both bacteria andeukaryotes is specifically inhibited by the antibiotic actinomycin D(Fig. 25-9). The planar portion of this molecule intercalates (insertsChapter 25 RNA MetabolismCCCAGccpCCCGAAAAAAAAc(a)(3')GGGTCGGGCGGATTA CI ! I I I ! I !M I N I(5')CCCAGCCCGCCTAATrJAGI ' I ' !' '• !! !'!T TCGGGCTTTTTTTT Q AAUAGTTTT(5')ACAAAA(3')Figure 25-8 A model for p-independent termination of transcription in E.

coli. (a) The poly(U) region is synthesized by RNA polymerase. (b) Intramolecular pairing of complementary sequences inthe RNA forms a hairpin, destroying part of theRNA-DNA hybrid. The remaining A=U hybridregion is relatively unstable, and (c) the RNAdissociates completely.UGC-GG-CC-GC-GC-GG-CCCCA-U(3')GGGTCGGGCGGATTACTCGCCCG(b)!CGGGCUUUUUUUU (3) | | | | |865A^AAAACI I II I I: I ! I ! ! I I I I i I I I ! I I I I I I i I(5')CCCAGCCCGCCTAATGAGCGGGCTUTGTTTT(5,}{3 }TT' I I I IIACAAAA(3')T rp rp rp rp r p GAA UGUACC-GG-CC-GC-GC-GSarL-ProSarL-meValD-ValL-ProL-meValD-ValO"iT-Thr(3')GGGTCGGGCGGATTACTCGCCCGAAAAAAAACTTGTTTT(5')(c)I I I I I I I i I I I I i I I I i I I I I I I I I I I I I I I I I I I I I II(5')CCCAGCCCGCCTAATGAGCGGGCTTTTTTTTGAACAAAA(3')UH3CH3Actinomycin Ditself) into the double-helical DNA between successive G = C basepairs, deforming the DNA.

This local alteration prevents the movement of the polymerase along the template. In effect, actinomycin Djams the zipper. Because actinomycin D inhibits RNA elongation inintact cells, as well as in cell extracts, it has become very useful foridentifying cell processes that depend upon RNA synthesis.

Acridineinhibits RNA synthesis in a similar fashion (Fig. 25-9).Rifampicin is an antibiotic inhibitor of RNA synthesis that bindsspecifically to the /3 subunit of bacterial RNA polymerases (see Fig.25-4), preventing the initiation of transcription. A specific inhibitor ofRNA synthesis in animal cells is a-amanitin, a toxic component of thepoisonous mushroom Amanita phalloides. It blocks mRNA synthesisby RNA polymerase II and, at higher concentrations, by RNA polymerase III. It does not affect RNA synthesis in bacteria. This mushroomhas developed a very effective defense mechanism: a substance thatinhibits mRNA formation in organisms that might try to eat it but isevidently harmless to the mushroom's own transcription mechanism.AcridineF i g u r e 2 5 - 9 Structure of actinomycin D a n d acridine, inhibitors of DNA transcription.

The shadedportion of actinomycin D is planar a n d intercalatesbetween two successive G = C base pairs in duplexDNA. The two cyclic peptide structures of the actinomycin D molecule bind to t h e minor groove of thedouble helix. Sarcosine (Sar) is iV-methylglycine;meVal represents methylvaline. The linkages between sarcosine, L-proline, a n d D-valine are peptidebonds.

Acridine also acts by intercalation in t h eDNA.Chapter 25 RNA Metabolism889proteins. Many proteins are clearly derived, at least in part, from exonshuffling during evolution. Walter Gilbert and colleagues have suggested that all present-day proteins may have been assembled from asfew as 1,000 to 7,000 primordial exons encoding small polypeptideseach 30 to 50 amino acids long.The origin of life still offers a major intellectual challenge. Eventhough we cannot go back billions of years and observe the eventsfirsthand, many clues to the puzzle lie buried in the fundamentalchemistry of living cells.Walter GilbertSummaryTranscription is catalyzed by DNA-directed RNApolymerase, a complex enzyme that synthesizesRNA complementary to a segment of one strand(the template strand) of duplex DNA, starting fromribonucleoside 5'-triphosphates.

To initiate transcription, RNA polymerase binds to a DNA sitecalled a promoter. Bacterial RNA polymerase requires a special subunit for recognizing the promoter. As the first committed step in transcription,binding of RNA polymerase to promoters is subjectto many forms of regulation. Eukaryotic cells havethree different types of RNA polymerases. Transcription stops at specific sequences called terminators. Many copies of an RNA chain can be transcribed simultaneously from a single gene.Ribosomal RNAs and transfer RNAs are madefrom longer precursor RNAs that are trimmed bynucleases, and some bases are modified enzymatically to yield the mature RNAs.

In eukaryotes,messenger RNAs are also formed from longer precursors. Primary RNA transcripts often containnoncoding regions called introns, which are removed by splicing. Group I introns are found inrRNAs and their excision requires a guanosine cofactor. Some group I and some group II introns arecapable of self-splicing; no protein enzymes arerequired. Nuclear mRNA precursors have a thirdclass of introns that are spliced with the aid ofRNA-protein complexes called snRNPs. Thefourth class of introns, found in some tRNAs, arethe only ones known to be spliced by protein enzymes. Messenger RNAs are also modified by addition of a 7-methylguanosine residue at the 5' end,and cleavage and polyadenylation at the 3' end toform a long poly(A) tail.The self-splicing introns and the RNA component of RNase P (the enzyme that cleaves the 5'end of tRNA precursors) form a new class of biological catalysts called ribozymes.

These have theproperties of true enzymes and are effective catalysts. They promote two types of reaction, hydrolytic cleavage and transesterification, using RNAas substrate. Combinations of these reactions arepromoted by the excised group I rRNA intron fromTetrahymena, resulting in a type of RNA polymerization reaction. The study of these reactions and ofintrons themselves has provided insights intolikely pathways for biochemical evolution.Polynucleotide phosphorylase can reversiblyform RNA-like polymers from ribonucleoside 5'diphosphates, adding or removing ribonucleotidesat the 3'-hydroxyl end of the polymer. It acts invivo to degrade RNA.RNA-directed DNA polymerases, also calledreverse transcriptases, are produced in animalcells infected by RNA viruses called retroviruses.These enzymes transcribe the viral RNA into DNA.This process can be used experimentally to formcomplementary DNA.

Many eukaryotic transposons are related to retroviruses, and their mechanism of transposition includes an RNA intermediate. The enzyme that synthesizes telomeres, calledtelomerase, is a specialized reverse transcriptasethat contains an internal RNA template.RNA-directed RNA polymerases, or replicases,are found in bacterial cells infected with certainRNA viruses. They are template-specific for theviral RNA.The existence of catalytic RNAs and pathwaysfor the interconversion of RNA and DNA has led tospeculation that the earliest living things weremade up entirely or largely of RNA molecules thatserved both for information storage and for catalysis of replication.Part IV Information PathwaysGeneralDarnell, J.E., Jr.

(1985) RNA. Sci. Am. 253 (October), 68-78.Evolution of Catalytic Function. (1987) ColdSpring Harb. Symp. Quant. Biol. 52.An excellent source for articles on catalytic RNA,evolution, and many other topics discussed in thischapter.Jacob, F. & Monod, J. (1961) Genetic regulatorymechanisms in the synthesis of proteins. J. Mol.Biol. 3, 318-356.A classic article that introduced many importantideas.Watson, J.D., Hopkins, N.H., Roberts, J.W.,Steitz, J.A., & Weiner, A.M.

Характеристики

Тип файла
PDF-файл
Размер
6,47 Mb
Материал
Тип материала
Высшее учебное заведение

Список файлов лекций

Свежие статьи
Популярно сейчас
А знаете ли Вы, что из года в год задания практически не меняются? Математика, преподаваемая в учебных заведениях, никак не менялась минимум 30 лет. Найдите нужный учебный материал на СтудИзбе!
Ответы на популярные вопросы
Да! Наши авторы собирают и выкладывают те работы, которые сдаются в Вашем учебном заведении ежегодно и уже проверены преподавателями.
Да! У нас любой человек может выложить любую учебную работу и зарабатывать на её продажах! Но каждый учебный материал публикуется только после тщательной проверки администрацией.
Вернём деньги! А если быть более точными, то автору даётся немного времени на исправление, а если не исправит или выйдет время, то вернём деньги в полном объёме!
Да! На равне с готовыми студенческими работами у нас продаются услуги. Цены на услуги видны сразу, то есть Вам нужно только указать параметры и сразу можно оплачивать.
Отзывы студентов
Ставлю 10/10
Все нравится, очень удобный сайт, помогает в учебе. Кроме этого, можно заработать самому, выставляя готовые учебные материалы на продажу здесь. Рейтинги и отзывы на преподавателей очень помогают сориентироваться в начале нового семестра. Спасибо за такую функцию. Ставлю максимальную оценку.
Лучшая платформа для успешной сдачи сессии
Познакомился со СтудИзбой благодаря своему другу, очень нравится интерфейс, количество доступных файлов, цена, в общем, все прекрасно. Даже сам продаю какие-то свои работы.
Студизба ван лав ❤
Очень офигенный сайт для студентов. Много полезных учебных материалов. Пользуюсь студизбой с октября 2021 года. Серьёзных нареканий нет. Хотелось бы, что бы ввели подписочную модель и сделали материалы дешевле 300 рублей в рамках подписки бесплатными.
Отличный сайт
Лично меня всё устраивает - и покупка, и продажа; и цены, и возможность предпросмотра куска файла, и обилие бесплатных файлов (в подборках по авторам, читай, ВУЗам и факультетам). Есть определённые баги, но всё решаемо, да и администраторы реагируют в течение суток.
Маленький отзыв о большом помощнике!
Студизба спасает в те моменты, когда сроки горят, а работ накопилось достаточно. Довольно удобный сайт с простой навигацией и огромным количеством материалов.
Студ. Изба как крупнейший сборник работ для студентов
Тут дофига бывает всего полезного. Печально, что бывают предметы по которым даже одного бесплатного решения нет, но это скорее вопрос к студентам. В остальном всё здорово.
Спасательный островок
Если уже не успеваешь разобраться или застрял на каком-то задание поможет тебе быстро и недорого решить твою проблему.
Всё и так отлично
Всё очень удобно. Особенно круто, что есть система бонусов и можно выводить остатки денег. Очень много качественных бесплатных файлов.
Отзыв о системе "Студизба"
Отличная платформа для распространения работ, востребованных студентами. Хорошо налаженная и качественная работа сайта, огромная база заданий и аудитория.
Отличный помощник
Отличный сайт с кучей полезных файлов, позволяющий найти много методичек / учебников / отзывов о вузах и преподователях.
Отлично помогает студентам в любой момент для решения трудных и незамедлительных задач
Хотелось бы больше конкретной информации о преподавателях. А так в принципе хороший сайт, всегда им пользуюсь и ни разу не было желания прекратить. Хороший сайт для помощи студентам, удобный и приятный интерфейс. Из недостатков можно выделить только отсутствия небольшого количества файлов.
Спасибо за шикарный сайт
Великолепный сайт на котором студент за не большие деньги может найти помощь с дз, проектами курсовыми, лабораторными, а также узнать отзывы на преподавателей и бесплатно скачать пособия.
Популярные преподаватели
Добавляйте материалы
и зарабатывайте!
Продажи идут автоматически
7250
Авторов
на СтудИзбе
246
Средний доход
с одного платного файла
Обучение Подробнее