6 Биосинтез нуклеиновых кислот (1160075), страница 14
Текст из файла (страница 14)
26-12). Its promoter varies greatly insequence from one species to another. RNA polymerase II (Pol II) hasthe central function of synthesizing mRNAs, as well as some specialfunction RNAs. This enzyme must recognize thousands of promoters,many of which share some key sequence similarities in most eukaryotes (Fig. 25-7). These sequences are generally binding sites for proteins called transcription factors, which modulate the binding ofRNA polymerase to the promoter. RNA polymerase III (Pol III) makestRNAs, the 5S rRNA, and some other small specialized RNAs. Thepromoter recognized by RNA polymerase III is well characterized.
Interestingly, some of the sequences required for the regulated initiationof transcription by RNA polymerase III are located within the geneitself, whereas others are found in more conventional locations beforethe RNA start site (Chapter 27).Specific Sequences Signal Termination of RNA SynthesisRNA synthesis proceeds until the RNA polymerase encounters a sequence that triggers its dissociation.
This process is not well understood in eukaryotes, and our focus again shifts to bacteria. In E. colithere are at least two classes of such termination signals or terminators. One class relies on a protein factor called p (rho), and the other isp-independent.The p-independent class has two distinguishing features (Fig.25-8). The first is a region that is transcribed into self-complementarysequences, permitting the formation of a hairpin structure (see Fig.12-21) centered 15 to 20 nucleotides before the end of the RNA. Thesecond feature is a run of adenylates in the template strand that aretranscribed into uridylates at the end of the RNA.
It is thought thatformation of the hairpin disrupts part of the RNA-DNA hybrid in thetranscription complex. The remaining hybrid duplex (oligoribo-Uoligodeoxy-A) contains a particularly unstable combination of bases,and the entire complex simply dissociates.The p-dependent terminators lack the sequence of repeated adenylates in the template but do usually have a short sequence that istranscribed to form a hairpin. RNA polymerase pauses at these sequences, and dissociates if p protein is present. The p protein has anATP-dependent RNA-DNA helicase activity and probably disrupts theRNA-DNA hybrid formed during transcription.
ATP is hydrolyzed by pprotein during the termination process, but the detailed mechanism bywhich the protein acts is not known.DNA-Directed RNA Polymerase Can Be Selectively InhibitedThe elongation of RNA chains by RNA polymerase in both bacteria andeukaryotes is specifically inhibited by the antibiotic actinomycin D(Fig. 25-9). The planar portion of this molecule intercalates (insertsChapter 25 RNA MetabolismCCCAGccpCCCGAAAAAAAAc(a)(3')GGGTCGGGCGGATTA CI ! I I I ! I !M I N I(5')CCCAGCCCGCCTAATrJAGI ' I ' !' '• !! !'!T TCGGGCTTTTTTTT Q AAUAGTTTT(5')ACAAAA(3')Figure 25-8 A model for p-independent termination of transcription in E.
coli. (a) The poly(U) region is synthesized by RNA polymerase. (b) Intramolecular pairing of complementary sequences inthe RNA forms a hairpin, destroying part of theRNA-DNA hybrid. The remaining A=U hybridregion is relatively unstable, and (c) the RNAdissociates completely.UGC-GG-CC-GC-GC-GG-CCCCA-U(3')GGGTCGGGCGGATTACTCGCCCG(b)!CGGGCUUUUUUUU (3) | | | | |865A^AAAACI I II I I: I ! I ! ! I I I I i I I I ! I I I I I I i I(5')CCCAGCCCGCCTAATGAGCGGGCTUTGTTTT(5,}{3 }TT' I I I IIACAAAA(3')T rp rp rp rp r p GAA UGUACC-GG-CC-GC-GC-GSarL-ProSarL-meValD-ValL-ProL-meValD-ValO"iT-Thr(3')GGGTCGGGCGGATTACTCGCCCGAAAAAAAACTTGTTTT(5')(c)I I I I I I I i I I I I i I I I i I I I I I I I I I I I I I I I I I I I I II(5')CCCAGCCCGCCTAATGAGCGGGCTTTTTTTTGAACAAAA(3')UH3CH3Actinomycin Ditself) into the double-helical DNA between successive G = C basepairs, deforming the DNA.
This local alteration prevents the movement of the polymerase along the template. In effect, actinomycin Djams the zipper. Because actinomycin D inhibits RNA elongation inintact cells, as well as in cell extracts, it has become very useful foridentifying cell processes that depend upon RNA synthesis.
Acridineinhibits RNA synthesis in a similar fashion (Fig. 25-9).Rifampicin is an antibiotic inhibitor of RNA synthesis that bindsspecifically to the /3 subunit of bacterial RNA polymerases (see Fig.25-4), preventing the initiation of transcription. A specific inhibitor ofRNA synthesis in animal cells is a-amanitin, a toxic component of thepoisonous mushroom Amanita phalloides. It blocks mRNA synthesisby RNA polymerase II and, at higher concentrations, by RNA polymerase III. It does not affect RNA synthesis in bacteria. This mushroomhas developed a very effective defense mechanism: a substance thatinhibits mRNA formation in organisms that might try to eat it but isevidently harmless to the mushroom's own transcription mechanism.AcridineF i g u r e 2 5 - 9 Structure of actinomycin D a n d acridine, inhibitors of DNA transcription.
The shadedportion of actinomycin D is planar a n d intercalatesbetween two successive G = C base pairs in duplexDNA. The two cyclic peptide structures of the actinomycin D molecule bind to t h e minor groove of thedouble helix. Sarcosine (Sar) is iV-methylglycine;meVal represents methylvaline. The linkages between sarcosine, L-proline, a n d D-valine are peptidebonds.
Acridine also acts by intercalation in t h eDNA.Chapter 25 RNA Metabolism889proteins. Many proteins are clearly derived, at least in part, from exonshuffling during evolution. Walter Gilbert and colleagues have suggested that all present-day proteins may have been assembled from asfew as 1,000 to 7,000 primordial exons encoding small polypeptideseach 30 to 50 amino acids long.The origin of life still offers a major intellectual challenge. Eventhough we cannot go back billions of years and observe the eventsfirsthand, many clues to the puzzle lie buried in the fundamentalchemistry of living cells.Walter GilbertSummaryTranscription is catalyzed by DNA-directed RNApolymerase, a complex enzyme that synthesizesRNA complementary to a segment of one strand(the template strand) of duplex DNA, starting fromribonucleoside 5'-triphosphates.
To initiate transcription, RNA polymerase binds to a DNA sitecalled a promoter. Bacterial RNA polymerase requires a special subunit for recognizing the promoter. As the first committed step in transcription,binding of RNA polymerase to promoters is subjectto many forms of regulation. Eukaryotic cells havethree different types of RNA polymerases. Transcription stops at specific sequences called terminators. Many copies of an RNA chain can be transcribed simultaneously from a single gene.Ribosomal RNAs and transfer RNAs are madefrom longer precursor RNAs that are trimmed bynucleases, and some bases are modified enzymatically to yield the mature RNAs.
In eukaryotes,messenger RNAs are also formed from longer precursors. Primary RNA transcripts often containnoncoding regions called introns, which are removed by splicing. Group I introns are found inrRNAs and their excision requires a guanosine cofactor. Some group I and some group II introns arecapable of self-splicing; no protein enzymes arerequired. Nuclear mRNA precursors have a thirdclass of introns that are spliced with the aid ofRNA-protein complexes called snRNPs. Thefourth class of introns, found in some tRNAs, arethe only ones known to be spliced by protein enzymes. Messenger RNAs are also modified by addition of a 7-methylguanosine residue at the 5' end,and cleavage and polyadenylation at the 3' end toform a long poly(A) tail.The self-splicing introns and the RNA component of RNase P (the enzyme that cleaves the 5'end of tRNA precursors) form a new class of biological catalysts called ribozymes.
These have theproperties of true enzymes and are effective catalysts. They promote two types of reaction, hydrolytic cleavage and transesterification, using RNAas substrate. Combinations of these reactions arepromoted by the excised group I rRNA intron fromTetrahymena, resulting in a type of RNA polymerization reaction. The study of these reactions and ofintrons themselves has provided insights intolikely pathways for biochemical evolution.Polynucleotide phosphorylase can reversiblyform RNA-like polymers from ribonucleoside 5'diphosphates, adding or removing ribonucleotidesat the 3'-hydroxyl end of the polymer. It acts invivo to degrade RNA.RNA-directed DNA polymerases, also calledreverse transcriptases, are produced in animalcells infected by RNA viruses called retroviruses.These enzymes transcribe the viral RNA into DNA.This process can be used experimentally to formcomplementary DNA.
Many eukaryotic transposons are related to retroviruses, and their mechanism of transposition includes an RNA intermediate. The enzyme that synthesizes telomeres, calledtelomerase, is a specialized reverse transcriptasethat contains an internal RNA template.RNA-directed RNA polymerases, or replicases,are found in bacterial cells infected with certainRNA viruses. They are template-specific for theviral RNA.The existence of catalytic RNAs and pathwaysfor the interconversion of RNA and DNA has led tospeculation that the earliest living things weremade up entirely or largely of RNA molecules thatserved both for information storage and for catalysis of replication.Part IV Information PathwaysGeneralDarnell, J.E., Jr.
(1985) RNA. Sci. Am. 253 (October), 68-78.Evolution of Catalytic Function. (1987) ColdSpring Harb. Symp. Quant. Biol. 52.An excellent source for articles on catalytic RNA,evolution, and many other topics discussed in thischapter.Jacob, F. & Monod, J. (1961) Genetic regulatorymechanisms in the synthesis of proteins. J. Mol.Biol. 3, 318-356.A classic article that introduced many importantideas.Watson, J.D., Hopkins, N.H., Roberts, J.W.,Steitz, J.A., & Weiner, A.M.
![](https://s.studizba.com/z.php?f=/templates/si/i/noavatar.png&w=100&h=100&t=1"){kind=avatar}
