Главная » Просмотр файлов » 5 Структура нуклеиновых кислот

5 Структура нуклеиновых кислот (1160074), страница 6

Файл №1160074 5 Структура нуклеиновых кислот (Лекции) 6 страница5 Структура нуклеиновых кислот (1160074) страница 62019-09-19СтудИзба
Просмтор этого файла доступен только зарегистрированным пользователям. Но у нас супер быстрая регистрация: достаточно только электронной почты!

Текст из файла (страница 6)

The pairedstrands in RNA or RNA-DNA are antiparallel, as in DNA.Figure 12-24 Typical right-handed stacking pattern found in a single strand of RNA. The basesare shown in white, the ribose rings in green, andthe phosphate atoms in yellow. The right-handedtwist of the backbone is evident.Part II Structure and Catalysis340HairpinSinglestrandsCGGHairpin double helix(b)(a)Figure 12-25 (a) Types of secondary structurefound in some RNAs. The paired regions generallyhave an A-form right-handed helix, as shown for ahairpin (b).CCUCAAC-240AUCCGG60 v A_UC G -UAAG '.GG^VG0' C GCUG1GCG(CCUUc u°GACAAAGCUGACCAGUUUGACUGG0u?AGAAGGUnlike the double helix of DNA, there is no simple, regular secondary structure that forms a reference point for RNA structure. Thqthree-dimensional structures of many RNAs, like those of proteins, articomplex and unique.

Weak interactions, especially base-stacking (hy-idrophobic) interactions, again play a major role in stabilizing structures. Where complementary sequences are present, the predominanldouble-stranded structure is an A-form right-handed double helixiZ-form helices have been made in the laboratory (under very high-saltor high-temperature conditions). The B form of RNA has not been observed. Breaks in the regular A-form helix caused by mismatched ofunmatched bases in one or both strands are common, and result inbulges or internal loops (Fig. 12-25). Hairpin loops form betweennearby self-complementary sequences in the RNA strand (Fig.

12-25).The potential for base-paired helical structures in many RNAs is extensive (Fig. 12-26), and the resulting hairpins can be considered the,most common type of secondary structure in RNA. Certain short basesequences, such as UUCG, are often found at the ends of RNA hairpinsand are known to form particularly tight and stable loops. Such se-)quences may play an important role in nucleating the folding of anRNA molecule into its precise three-dimensional structure. Importantadditional structural contributions are made by hydrogen bonds thatare not part of standard Watson-Crick base pairs.

For example, the2'-hydroxyl group of ribose can form a hydrogen bond with othergroups, and a variety of nonstandard base-pairing patterns are alsoobserved. Some of these properties are evident in the structure of the'.'phenylalanine transfer RNA of yeast (Fig. 12-27).\GoN'N(,330ACUGUN-H v UracilccAC\GANH2GuanineFigure 12-26 Possible secondary structure of theMl RNA component of the enzyme RNase P ofE. coli, showing many hairpins. RNase P also contains a protein component (not shown).

This enzyme functions in the processing of transfer RNAs,as described in Chapter 25. Brackets indicate additional complementary sequences that may be pairedin the three-dimensional structure. The dots (•) indicate non-Watson-Crick G=U base pairs, asshown above.341Chapter 12 Nucleotides and Nucleic AcidsFigure 12-27 Phenylalanine tRNA of yeast.(a) Three-dimensional structure, (b) Some unusualbase-pairing patterns. Note also the involvement ofa phosphodiester bond oxygen in one hydrogenbonding arrangement, and the involvement of a2'-hydroxyl group in another (both in red)./Cytosine= \HRibose-N/V-NO=P—O-\RiboseVXV^rVHNHN-< JGuanineThe analysis of RNA structure and its relationship to function is anemerging field of inquiry that has many of the same complexities asthe analysis of protein structure.

The importance of understandingRNA structure grows as we become aware of an increasing number offunctions of RNA molecules.+//O^*CH 37-MethylguanineHAdenineN—HIMONRiboseNinH—NN=iV2-DimethylguanineNucleic Acid ChemistryTo understand how nucleic acids function, we must understand theirchemical properties as well as their structures. DNA functions well asa repository of genetic information in part because of its inherent stability. The chemical transformations that do occur are generally veryslow in the absence of an enzyme catalyst. The long-term storage ofinformation without alteration is so important to a cell, however, thateven very slow reactions that alter DNA structure can be physiologically significant. Processes such as carcinogenesis and aging may beintimately linked to slowly accumulating, irreversible alterations ofDNA.

Nondestructive alterations, such as the strand separation thatmust precede DNA replication or transcription, are also important. Inaddition to providing these insights into physiological processes, ourunderstanding of nucleic acid chemistry has given us a powerful arrayof technologies that have applications in molecular biology, medicine,and forensic science. We now examine the chemical properties of DNAand some of these technologies.CH 3 CH 3UracilNH 2AdenineDouble-Helical DNA and RNA Can Be DenaturedSolutions of carefully isolated, native DNA are highly viscous at pH 7.0and room temperature (20 to 25 °C).

When such a solution is subjectedto extremes of pH or to temperatures above 80 to 90 °C, its viscositydecreases sharply, indicating that the DNA has undergone a physicalchange. Just as heat and extremes of pH cause denaturation of globular proteins, so too will they cause denaturation or melting of doublehelical DNA. This involves disruption of the hydrogen bonds betweenthe paired bases and the hydrophobic interactions between the stackedbases.

As a result, the double helix unwinds to form two single strands,O^ yThymineCH3(b)Partially denaturedDNA^Separationof strandsAssociation ofstrands by basepairingSeparated strandsof DNA in random coilsFigure 12-28 Stages in the reversible denaturation and annealing (renaturation) of DNA.Figure 12-29 (a) The denaturation or meltingcurve of two DNA specimens. The temperature atthe midpoint of the transition (tm) is the meltingpoint; it depends on pH and ionic strength, and onthe size and base composition of the DNA.

(b) Relationship between tm and the G=C content of aDNA, in a solution containing 0.15 M NaCl andcompletely separate from each other along the entire length, or part athe length (partial denaturation), of the molecule. No covalent bonds ithe DNA are broken (Fig. 12-28).Renaturation of DNA is a rapid one-step process as long as tdouble-helical segment of a dozen or more residues still unites thetwstrands. When the temperature or pH is returned to the biologicarange, the unwound segments of the two strands spontaneously rewind or anneal to yield the intact duplex (Fig. 12-28).

However, if thtwo strands are completely separated, renaturation occurs in twsteps. The first step is relatively slow, because the two strands muafirst "find" each other by random collisions and form a short segment dcomplementary double helix. The second step is much faster: the remaining unpaired bases successively come into register as base pairsand the two strands "zipper" themselves together to form the doublhelix.Viral or bacterial DNA molecules in solution denature at characteristic temperatures when they are heated slowly (Fig.

12-29). Thetransition from double-stranded DNA to the single-stranded, dena*tured form can be detected by an increase in the absorption of UVlighjJ(the hyperchromic effect) or a decrease in the viscosity of the DMsolution. Each species of DNA has a characteristic denaturation tern*perature or melting point: the higher its content of G—C base pairsfthe higher the melting point of the DNA. This is because G=C bas|pairs, with three hydrogen bonds, are more stable and require modheat energy to dissociate than A = T base pairs. Careful determination:of the melting point of a DNA specimen, under fixed conditions of pKand ionic strength, can yield an estimate of its base composition, ifdenaturation conditions are carefully controlled, regions that are rictfin A = T base pairs will specifically denature while most of the DNlremains double-stranded.

Such denatured regions can be visualizedwith electron microscopy (Fig. 12-30). Strand separation of DNA mudoccur in vivo during processes such as DNA replication and transcription. As we will see, the DNA sites where these processes are initiated,are often rich in A = T base pairs.Double-stranded nucleic acids with two RNA strands or with oneRNA strand and one DNA strand (RNA-DNA hybrids) can also bedenatured. Notably, RNA duplexes are more stable than DNA du-0.015 M sodium citrate.100 r100 rI 80605S40o7534280Temperature (°C)(a)852060708090(b)100110343Figure 12—30 Electron micrograph of partiallydenatured DNA. Few structural details are evident.The shadowing method used to visualize the DNAincreases its diameter approximately fivefold andobliterates the details of the helix. However, lengthmeasurements can be obtained, and single-strandedregions are readily distinguished from doublestranded regions.

The arrows point to some singlestranded bubbles in the DNA, where denaturationhas occurred. The regions that denature are highlyreproducible and are rich in A=T base pairs.plexes. At neutral pH, a double-helical RNA will often denature attemperatures 20 °C or more higher than a DNA molecule with a comparable sequence.

The stability of an RNA-DNA hybrid is generallyintermediate between that of RNA and that of DNA. The physical basisfor these differences in stability is not known.Nucleic Acids from Different Species Can Form HybridsThe capability of two complementary DNA strands to pair with oneanother can be used to detect similar DNA sequences in two differentspecies or within the genome of a single species. If duplex DNAs isolated from human cells and from mouse cells are completely denaturedby heating, then mixed and kept at 65 °C for many hours, much of theDNA will anneal. Most of the mouse DNA strands anneal with complementary mouse DNA strands to form mouse duplex DNA; similarly,many of the human DNA strands anneal with complementary humanDNA strands.

However, some strands of the mouse DNA will associatewith human DNA strands to yield hybrid duplexes, in which segments of the mouse DNA strand form base-paired regions with segments of the human DNA strand (Fig. 12-31). This reflects the factthat different organisms have some common evolutionary heritage;they generally have some proteins and RNAs with similar functionsand, often, similar structures. In many cases, the DNA encoding theseproteins and RNAs will have similar (homologous) sequences.

Характеристики

Тип файла
PDF-файл
Размер
5 Mb
Материал
Тип материала
Высшее учебное заведение

Список файлов лекций

Свежие статьи
Популярно сейчас
Как Вы думаете, сколько людей до Вас делали точно такое же задание? 99% студентов выполняют точно такие же задания, как и их предшественники год назад. Найдите нужный учебный материал на СтудИзбе!
Ответы на популярные вопросы
Да! Наши авторы собирают и выкладывают те работы, которые сдаются в Вашем учебном заведении ежегодно и уже проверены преподавателями.
Да! У нас любой человек может выложить любую учебную работу и зарабатывать на её продажах! Но каждый учебный материал публикуется только после тщательной проверки администрацией.
Вернём деньги! А если быть более точными, то автору даётся немного времени на исправление, а если не исправит или выйдет время, то вернём деньги в полном объёме!
Да! На равне с готовыми студенческими работами у нас продаются услуги. Цены на услуги видны сразу, то есть Вам нужно только указать параметры и сразу можно оплачивать.
Отзывы студентов
Ставлю 10/10
Все нравится, очень удобный сайт, помогает в учебе. Кроме этого, можно заработать самому, выставляя готовые учебные материалы на продажу здесь. Рейтинги и отзывы на преподавателей очень помогают сориентироваться в начале нового семестра. Спасибо за такую функцию. Ставлю максимальную оценку.
Лучшая платформа для успешной сдачи сессии
Познакомился со СтудИзбой благодаря своему другу, очень нравится интерфейс, количество доступных файлов, цена, в общем, все прекрасно. Даже сам продаю какие-то свои работы.
Студизба ван лав ❤
Очень офигенный сайт для студентов. Много полезных учебных материалов. Пользуюсь студизбой с октября 2021 года. Серьёзных нареканий нет. Хотелось бы, что бы ввели подписочную модель и сделали материалы дешевле 300 рублей в рамках подписки бесплатными.
Отличный сайт
Лично меня всё устраивает - и покупка, и продажа; и цены, и возможность предпросмотра куска файла, и обилие бесплатных файлов (в подборках по авторам, читай, ВУЗам и факультетам). Есть определённые баги, но всё решаемо, да и администраторы реагируют в течение суток.
Маленький отзыв о большом помощнике!
Студизба спасает в те моменты, когда сроки горят, а работ накопилось достаточно. Довольно удобный сайт с простой навигацией и огромным количеством материалов.
Студ. Изба как крупнейший сборник работ для студентов
Тут дофига бывает всего полезного. Печально, что бывают предметы по которым даже одного бесплатного решения нет, но это скорее вопрос к студентам. В остальном всё здорово.
Спасательный островок
Если уже не успеваешь разобраться или застрял на каком-то задание поможет тебе быстро и недорого решить твою проблему.
Всё и так отлично
Всё очень удобно. Особенно круто, что есть система бонусов и можно выводить остатки денег. Очень много качественных бесплатных файлов.
Отзыв о системе "Студизба"
Отличная платформа для распространения работ, востребованных студентами. Хорошо налаженная и качественная работа сайта, огромная база заданий и аудитория.
Отличный помощник
Отличный сайт с кучей полезных файлов, позволяющий найти много методичек / учебников / отзывов о вузах и преподователях.
Отлично помогает студентам в любой момент для решения трудных и незамедлительных задач
Хотелось бы больше конкретной информации о преподавателях. А так в принципе хороший сайт, всегда им пользуюсь и ни разу не было желания прекратить. Хороший сайт для помощи студентам, удобный и приятный интерфейс. Из недостатков можно выделить только отсутствия небольшого количества файлов.
Спасибо за шикарный сайт
Великолепный сайт на котором студент за не большие деньги может найти помощь с дз, проектами курсовыми, лабораторными, а также узнать отзывы на преподавателей и бесплатно скачать пособия.
Популярные преподаватели
Добавляйте материалы
и зарабатывайте!
Продажи идут автоматически
7271
Авторов
на СтудИзбе
244
Средний доход
с одного платного файла
Обучение Подробнее