Часть 1 (1120999), страница 80

Файл №1120999 Часть 1 (B. Alberts, A. Johnson, J. Lewis и др. - Molecular Biology of The Cell (5th edition)) 80 страницаЧасть 1 (1120999) страница 802019-05-09СтудИзба
Просмтор этого файла доступен только зарегистрированным пользователям. Но у нас супер быстрая регистрация: достаточно только электронной почты!

Текст из файла (страница 80)

Most of the genetic changes thatoccur result simply from failures in the normal mechanisms by which genomesare copied or repaired when damaged, although the movement of transposableDNA elements also plays an important role. As we will discuss in chapter 5, themechanisms that maintain DNA sequences are remarkably precise-but theyare not perfect.

For example, because of the elaborate DNA-replication andDNA-repair mechanisms that enable DNA sequences to be inherited withextraordinary fidelity, along a given line of descent only about one nucleotidepair in a thousand is randomly changed in the germline every million years.Even so, in a population of 10,000diploid individuals, every possible nucleotidesubstitution will have been "tried out" on about 20 occasions in the course of amillion years-a short span of time in relation to the evolution of species.Errors in DNA replication, DNA recombination, or DNA repair can lead eitherto simple changes in DNA sequence-such as the substitution of one base pairfor another-or to large-scalegenome rearrangements such as deletions, duplications, inversions,and translocations of DNA from one chromosome to another.In addition to these failures of the genetic machinery, the various mobile DNAelements that will be described in chapter 5 are an important source of genomicchange (seeTable 5-3, p.

318). These transposable DNA elements (ransposons)247HOW GENOMESEVOLVEare parasitic DNA sequences that colonize genomes and can spread withinthem. In the process, they often disrupt the function or alter the regulation ofexisting genes. On occasion, they can even create altogether novel genesthrough fusions between transposon sequencesand segmentsof existing genes.Over long periods of evolutionary time, transposons have profoundly affectedthe structure of genomes. In fact, nearly half of the DNA in the human genomehas recognizable sequence similarity with known transposon sequences,thereby indicating that these sequences are remnants of past transpositionevents (see Figure 4-17).

Even more of our genome is no doubt derived fromtransposition events that occurred so long ago (>l0B years) that the sequencescan no longer be traced to transposons.TheGenomeSequencesof TwoSpeciesDifferin Proportiontothe Lengthof TimeThatTheyHaveSeparatelyEvolvedThe differences between the genomes of species alive today have accumulatedover more than 3 billion years. Lacking a direct record of changes over time, wecan nevertheless reconstruct the process of genome evolution from detailedcomparisons of the genomes of contemporary organisms.The basic tool of comparative genomics is the phylogenetic tree.

A simpleexample is the tree describing the divergence of humans from the great apes(Figure 4-75). The primary support for this tree comes from comparisons ofgene or protein sequences.For example, comparisons between the sequencesofhuman genes or proteins and those of the great apes tlpically reveal the fewestdifferencesbetween human and chimpanzee and the most between human andorangutan.For closely related organisms such as humans and chimpanzees, it is relatively easyto reconstruct the gene sequencesof the extinct, last common ancestor of the two species (Figure 4-76).

The close similarity between human andchimpanzee genesis mainly due to the short time that has been available for theaccumulation of mutations in the two diverging lineages, rather than to functional constraints that have kept the sequencesthe same. Evidence for this viewcomes from the observation that even DNA sequenceswhose nucleotide orderis functionally unconstrained-such as the sequences that code for the fibrinopeptides (seep. 264) or the third position of "synonymous" codons (codonsspecifying the same amino acid-see Figure 4-76)-are nearly identical inhumans and chimpanzees.For much less closely related organisms, such as humans and chickens(which have evolved separatelyfor about 300 million years), the sequence conservation found in genes is largely due to purifying selection (that is, selectionthat eliminates individuals carrying mutations that interfere with importantgenetic functions), rather than to an inadequate time for mutations to occur.

Asa result, protein-coding, RNA-coding, and regulatory sequencesin the DNA areoften remarkably conserved. In contrast, most DNA sequences in the humanand chicken genomes have diverged so far due to multiple mutations that it isoften impossible to align them with one another.15l a s tc o m m o na n c e s t o r15 ccooo-l!Iro='1 0 ' -o@6oolcvf0.5 -coioocEhumanchimpanzeegorilla00o r an g u l a nFigure4-75 A phylogenetictree showingthe relationshipbetweenthe human andthe great apes basedon nucleotidethe sequencessequencedata,As indicated,of the genomesof allfour speciesareestimatedto differfrom the sequenceofthe genomeof their lastcommonancestorchangesoccurBecauseby a littleover 1.5ol0.on both diverginglineages,independentlypairwisecomparisonsrevealtwicethefrom the lastsequencedivergenceForexamPle,commonancestor.typicallycomparisonshuman-orangutanof a littleovershowsequencedivergenceswhile human-chimpanzee3olo,ofshowdivergencescomparisons(Modifiedfromapproximately1.2olo.F.C.Chenand W.H.Li,Am.J.

Hum.Genet.68:444-456,2001.With permissionfromof ChicagoPress.)University248Chapter4: DNA,Chromosomes,and Genomesgorilla c.laFigure 4-T6Tracingthe ancestralOsequencefrom a sequencecomparisonNUMAN GTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGof the codingregionsof human and||||||lillIt||||I|Iil||||||||l||||lChIMP GTGCCCATCCAAAAAGTCCAGGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGchimpanzeeleptin genes.Leptinis aPTOIEiNVP I Q K V Q D D T K T L I K T I V T Rhormonethat regulatesfood intakeandenergyutilizationin responseto theadequacyoffat reserves.As indicatedbythe codonsboxedin green,onlyKhuman aTcaaTGACATTTCACACACGCAGTCAGTCTCCTCCAAACAGAAAGTCACcGGTTTGGAC 5 nucleotides(of 441 total) differllll|| | | |l | | | | | | | | | | | | 1il il1 | | | | | ||lbetweenthesetwo sequences.Moreovet1ilililpAlLsluAUAr-1-IuALACACGCAGTCAGTCTCCTCCAAACAGAAGGTCACCGGTTTGGACproteinr N D r s H T o s v s S K e KVwhen the aminoacidsencodedby bothT G L Dgorilla aecthe humanand chimpanzeesequencesareexamined,in only one of the 5gorilla cccpositionsdoesthe encodedaminoacidPNUMANTTCATTCCTGGGCTCCACCCCATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTCdiffer.Foreachof the 5 variantnucleotidellll||||l||ilt|||||lil|1||l|||l||||||lpositions,the correspondingsequenceinchimp TTceltccTccccTccACccTATCCTGACCTTATcCAAGATGGACCAGACACTGGCAGTCthe gorillais alsoindicated.In two cases,IPGLHPILTLPTOIEIN FSKMDTLAVQthe gorillasequenceagreeswith thehumansequence,while in threecasesitagreeswith the chimpanzeesequence.vWhatwasthe sequenceof the leptinhuman tacC.qacAGATCCTCACCAGTATGCCTTCCAGAAAcGTGATCCAAATATCCAACGAccTcgenein the lastcommonancestor?An||l|||||||||||l|l||!I||l|il||||1il|lchimp TaccaacAGATccTcACCAGTATGCCTTCCAGAAACATGATCCAAATATCCAAccAccTcevolutionarymodelthat seekstoprotein v O O r L T s M p s R N M r e r s N D Lminimizethe numberof mutationsgorilla ATGpostulatedto haveoccurredduringtheevolutionof the humanand chimpanzeeDgeneswould assumethat the leptinhuman caceaccrcccccATCTTCTTCAGGTGcrccccrrcrcrAAGAGCTGCCACTTGCCCTGGsequenceof the lastcommonancestor|||l|||tl|l||l||||l||||!|||l|||||tlchimp GAGAACcrcccccAccrrcrrcAGGTGCTGGccrrcrcrAAGAGCTGCcACTTGCccrGGw a st h e s a m ea st h e h u m a na n dpTotein E N L R D L L H V L A F S K S c H L P Wchimpanzeesequenceswhen they agree;gorilla cAcwhen they disagree,it would usethegorillasequenceasa tie-breaker.Forconvenience,onlythe firstPhylogeneticTreesConstructed300 nucleotidesof the leptincodingfrom a Comparisonof DNAgiven.sequencesareThe remainingSequencesTracethe Relationshipsof All Organisms141areidenticalbetweenhumansandchimoanzees.Integrationphylogenetic-him^oftrees based on molecular sequence comparisonswith the fossil record has led to the best available view of the evolution of modern life forms.

The fossil record remains important as a source of absolute datesbased on the decay of radioisotopes in the rock formations in which fossils arefound. However, precise divergence times between speciesare difficult to establish from the fossil record, even for species that leave good fossils with distinctive morphology.Such integrated phylogenetic trees suggestthat changes in the sequencesofparticular genes or proteins tend to occur at a nearly constant rate, althoughrates that differ from the norm by as much as twofold are observed in particularlineages.As discussedabove and in Chapter 5, this "molecular clock" runs mostrapidly and regularly in sequencesthat are not subject to purifying selectionsuch as intergenic regions, portions of introns that lack splicing or regulatorysignals, and genes that have been irreversibly inactivated by mutation (the socalled pseudogenes).The clock runs most slowly for sequencesthat are subjectto strong functional constraints-for example, the amino acid sequencesof proteins such as actin that engage in specific interactions with large numbers ofother proteins and whose structure is therefore highly constrained (see, forexample,Figure 16-18).Occasionally, rapid change is seen in a previously highly conservedsequence.As discussedlater in this chapter, such episodes are especially interesting becausethey are thought to reflect periods of strong positive selection formutations that conferred a selective advantage in the particular lineage wherethe rapid change occurred.Molecular clocks run at rates that are determined both by mutation rates andby the degree of purifying selection on particular sequences.Therefore, a completely different calibration is required for those genes replicated and repaired bydifferent systems within cells.

Most notably, in animals, although not in plants,clocks based on functionally unconstrained mitochondrial DNA sequencesrun:' .HOWGENOMESEVOLVEopossumwallabyancesrorarmadillohedgehogbatcowsheep- I n d i a nm u n t j a kpr9rabbitmouSe,,:,,::,',,;',:',,:,::".,.,,;',1Figure 4-77 A phylogenetictreehighlightingsomeof the mammalswhose genomesare being extensivelystudied.The lengthof eachlineisproportionalto the numberof "neutralthesubstitutions"-representingnucleotidechangesobservedin the(Adaptedabsenceof purifyingselection.from G.M.Cooperet al.,GenomeRes.from15:901-913, 2005.With permissionCold SpringHarborLaboratoryPress.)garagomarmosels q u i r r e lm o n k e yvervetbaboonmacaqueo r an g u l a nqorillacnrmpnumanmuch faster than clocks based on functionally unconstrained nuclear sequences,due to an unusually high mutation rate in animal mitochondria.Molecular clocks have a finer time resolution than the fossil record and area more reliable guide to the detailed structure of phylogenetic trees than areclassicalmethods of tree construction, which are based on comparisons of themorphology and development of different species.For example,the precise relationship among the great-ape and human lineages was not settled until sufficient molecular-sequence data accumulated in the 1980s to produce the treethat was shor,rmin Figure 4-75.

And with huge amounts of DNA sequence nowdetermined from a variety of mammals, much better estimates of our relationship to them are being obtained (Figure 4-77).A Comparisonof Humanand MouseChromosomesShowsHowTheStructuresof GenomesDivergeAs would be expected, the human and chimpanzee genomes are much morealike than are the human and mouse genomes. Although the size of the humanand mouse genomes are roughly the same and they contain nearly identical setsof genes, there has been a much longer time period over which changes havehad a chance to accumulate-approximately80 million years versus 6 millionyears.

Характеристики

Тип файла
PDF-файл
Размер
78,48 Mb
Тип материала
Предмет
Высшее учебное заведение

Список файлов книги

Свежие статьи
Популярно сейчас
Почему делать на заказ в разы дороже, чем купить готовую учебную работу на СтудИзбе? Наши учебные работы продаются каждый год, тогда как большинство заказов выполняются с нуля. Найдите подходящий учебный материал на СтудИзбе!
Ответы на популярные вопросы
Да! Наши авторы собирают и выкладывают те работы, которые сдаются в Вашем учебном заведении ежегодно и уже проверены преподавателями.
Да! У нас любой человек может выложить любую учебную работу и зарабатывать на её продажах! Но каждый учебный материал публикуется только после тщательной проверки администрацией.
Вернём деньги! А если быть более точными, то автору даётся немного времени на исправление, а если не исправит или выйдет время, то вернём деньги в полном объёме!
Да! На равне с готовыми студенческими работами у нас продаются услуги. Цены на услуги видны сразу, то есть Вам нужно только указать параметры и сразу можно оплачивать.
Отзывы студентов
Ставлю 10/10
Все нравится, очень удобный сайт, помогает в учебе. Кроме этого, можно заработать самому, выставляя готовые учебные материалы на продажу здесь. Рейтинги и отзывы на преподавателей очень помогают сориентироваться в начале нового семестра. Спасибо за такую функцию. Ставлю максимальную оценку.
Лучшая платформа для успешной сдачи сессии
Познакомился со СтудИзбой благодаря своему другу, очень нравится интерфейс, количество доступных файлов, цена, в общем, все прекрасно. Даже сам продаю какие-то свои работы.
Студизба ван лав ❤
Очень офигенный сайт для студентов. Много полезных учебных материалов. Пользуюсь студизбой с октября 2021 года. Серьёзных нареканий нет. Хотелось бы, что бы ввели подписочную модель и сделали материалы дешевле 300 рублей в рамках подписки бесплатными.
Отличный сайт
Лично меня всё устраивает - и покупка, и продажа; и цены, и возможность предпросмотра куска файла, и обилие бесплатных файлов (в подборках по авторам, читай, ВУЗам и факультетам). Есть определённые баги, но всё решаемо, да и администраторы реагируют в течение суток.
Маленький отзыв о большом помощнике!
Студизба спасает в те моменты, когда сроки горят, а работ накопилось достаточно. Довольно удобный сайт с простой навигацией и огромным количеством материалов.
Студ. Изба как крупнейший сборник работ для студентов
Тут дофига бывает всего полезного. Печально, что бывают предметы по которым даже одного бесплатного решения нет, но это скорее вопрос к студентам. В остальном всё здорово.
Спасательный островок
Если уже не успеваешь разобраться или застрял на каком-то задание поможет тебе быстро и недорого решить твою проблему.
Всё и так отлично
Всё очень удобно. Особенно круто, что есть система бонусов и можно выводить остатки денег. Очень много качественных бесплатных файлов.
Отзыв о системе "Студизба"
Отличная платформа для распространения работ, востребованных студентами. Хорошо налаженная и качественная работа сайта, огромная база заданий и аудитория.
Отличный помощник
Отличный сайт с кучей полезных файлов, позволяющий найти много методичек / учебников / отзывов о вузах и преподователях.
Отлично помогает студентам в любой момент для решения трудных и незамедлительных задач
Хотелось бы больше конкретной информации о преподавателях. А так в принципе хороший сайт, всегда им пользуюсь и ни разу не было желания прекратить. Хороший сайт для помощи студентам, удобный и приятный интерфейс. Из недостатков можно выделить только отсутствия небольшого количества файлов.
Спасибо за шикарный сайт
Великолепный сайт на котором студент за не большие деньги может найти помощь с дз, проектами курсовыми, лабораторными, а также узнать отзывы на преподавателей и бесплатно скачать пособия.
Популярные преподаватели
Добавляйте материалы
и зарабатывайте!
Продажи идут автоматически
7318
Авторов
на СтудИзбе
241
Средний доход
с одного платного файла
Обучение Подробнее