Главная » Просмотр файлов » B. Alberts, A. Johnson, J. Lewis и др. - Molecular Biology of The Cell (6th edition)

B. Alberts, A. Johnson, J. Lewis и др. - Molecular Biology of The Cell (6th edition) (1120996), страница 83

Файл №1120996 B. Alberts, A. Johnson, J. Lewis и др. - Molecular Biology of The Cell (6th edition) (B. Alberts, A. Johnson, J. Lewis и др. - Molecular Biology of The Cell (6th edition)) 83 страницаB. Alberts, A. Johnson, J. Lewis и др. - Molecular Biology of The Cell (6th edition) (1120996) страница 832019-05-09СтудИзба
Просмтор этого файла доступен только зарегистрированным пользователям. Но у нас супер быстрая регистрация: достаточно только электронной почты!

Текст из файла (страница 83)

The LINEs(long interspersed nuclear elements), SINEs(short interspersed nuclear elements),retroviral-like elements, and DNA-onlytransposons are mobile genetic elementsthat have multiplied in our genome byreplicating themselves and inserting thenew copies in different positions.

Thesemobile genetic elements are discussed inChapter 5 (see Table 5–3, p. 267). Simplesequence repeats are short nucleotidesequences (less than 14 nucleotide pairs)that are repeated again and again for longstretches. Segmental duplications are largeblocks of DNA sequence (1000–200,000nucleotide pairs) that are present at twoor more locations in the genome. Themost highly repeated blocks of DNAin heterochromatin have not yet beencompletely sequenced; therefore about10% of human DNA sequences are notrepresented in this diagram.

(Data courtesyof E. Margulies.)HOW GENOMES EVOLVElast common ancestor1.5101.0500.5humanchimpanzee gorillaorangutanpercent nucleotide substitutionmillions of years before present152190.0that have kept the sequences the same. Evidence for this view comes from theobservation that the human and chimpanzee genomes are nearly identical evenwhere there is no functional constraint on the nucleotide sequence—such as inthe third position of “synonymous”(codons specifying the same aminoMBoC6codonsm4.75/4.62acid but differing in their third nucleotide).For much less closely related organisms, such as humans and chickens (whichhave evolved separately for about 300 million years), the sequence conservationfound in genes is almost entirely due to purifying selection (that is, selection thateliminates individuals carrying mutations that interfere with important geneticfunctions), rather than to an inadequate time for mutations to occur.Figure 4–63 A phylogenetic treeshowing the relationship betweenhumans and the great apes based onnucleotide sequence data.

As indicated,the sequences of the genomes of all fourspecies are estimated to differ from thesequence of the genome of their lastcommon ancestor by a little over 1.5%.Because changes occur independentlyon both diverging lineages, pairwisecomparisons reveal twice the sequencedivergence from the last commonancestor. For example, human–orangutancomparisons typically show sequencedivergences of a little over 3%, whilehuman–chimpanzee comparisons showdivergences of approximately 1.2%.(Modified from F.C.

Chen and W.H. Li,Am. J. Hum. Genet. 68:444–456, 2001.)Phylogenetic Trees Constructed from a Comparison of DNASequences Trace the Relationships of All OrganismsPhylogenetic trees based on molecular sequence data can be compared withthe fossil record, and we get our best view of evolution by integrating the twoapproaches. The fossil record remains essential as a source of absolute dates,gorilla CAAQ160human GTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGchimp GTGCCCATCCAAAAAGTCCAGGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGprotein V P I Q K V Q D D T K T L I K T I V T RK61120human ATCAATGACATTTCACACACGCAGTCAGTCTCCTCCAAACAGAAAGTCACCGGTTTGGACchimp ATCAATGACATTTCACACACGCAGTCAGTCTCCTCCAAACAGAAGGTCACCGGTTTGGACprotein I N D I S H T O S V S S K Q K V T G L Dgorilla AAGgorilla CCCP121180human TTCATTCCTGGGCTCCACCCCATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTCchimp TTCATTCCTGGGCTCCACCCTATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTCprotein F I P G L H P I L T L S K M D Q T L A VV181240human TACCAACAGATCCTCACCAGTATGCCTTCCAGAAACGTGATCCAAATATCCAACGACCTGchimp TACCAACAGATCCTCACCAGTATGCCTTCCAGAAACATGATCCAAATATCCAACGACCTGprotein Y Q Q I L T S M P S R N M I Q I S N D Lgorilla ATGD241300human GAGAACCTCCGGGATCTTCTTCAGGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGGchimp GAGAACCTCCGGGACCTTCTTCAGGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGGprotein E N L R D L L H V L A F S K S C H L P Wgorilla GACFigure 4–64 Tracing the ancestralsequence from a sequence comparisonof the coding regions of human andchimpanzee leptin genes.

Reading leftto right and top to bottom, a continuous300-nucleotide segment of a leptin-codinggene is illustrated. Leptin is a hormonethat regulates food intake and energyutilization in response to the adequacy offat reserves. As indicated by the codonsboxed in green, only 5 nucleotides (of441 total) differ between the two species.Moreover, in only one of the five positionsdoes the difference in nucleotide lead toa difference in the encoded amino acid.For each of the five variant nucleotidepositions, the corresponding sequence inthe gorilla is also indicated. In two cases,the gorilla sequence agrees with the humansequence, while in three cases it agreeswith the chimpanzee sequence.What was the sequence of the leptin genein the last common ancestor? The mosteconomical assumption is that evolutionhas followed a pathway requiring theminimum number of mutations consistentwith the data.

Thus, it seems likely thatthe leptin sequence of the last commonancestor was the same as the human andchimpanzee sequences when they agree;when they disagree, the gorilla sequencewould be used as a tiebreaker. Forconvenience, only the first 300 nucleotidesof the leptin-coding sequences are given.The remaining 141 are identical betweenhumans and chimpanzees.220Chapter 4: DNA, Chromosomes, and GenomesexonintronmouseGTGCCTATCCAGAAAGTCCAGGATGACACCAAAACCCTCATCAAGACCATTGTCACCAGGATCAATGACATTTCACACACGGTA-GGAGTCTCATGGGGGGACAAAGATGTAGGACTAGAGTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCACACACGGTAAGGAGAGT-ATGCGGGGACAAA---GTAGAACTGCAhumanmouseACCAGAGTCTGAGAAACATGTCATGCACCTCCTAGAAGCTGAGAGTTTAT-AAGCCTCGAGTGTACAT-TATTTCTGGTCATGGCTCTTGTCACTGCTGCCTGCTGAAATACAGGGCTGAGCCAG--CCC-AGCACTGGCTCCTAGTGGCACTGGACCCAGATAGTCCAAGAAACATTTATTGAACGCCTCCTGAATGCCAGGCACCTACTGGAAGCTGA--GAAGGATTTGAAAGCACAhumanFigure 4–65 The very different rates of evolution of exons and introns, as illustrated by comparing a portion of themouse and human leptin genes.

Positions where the sequences differ by a single nucleotide substitution are boxed in green,and positions that differ by the addition or deletion of nucleotides are boxed in yellow. Note that, thanks to purifying selection,the coding sequence of the exon is much more conserved than is the adjacent intron sequence.based on radioisotope decay in the rock formationsin whichfossils are found.MBoC6m4.78/4.65Because the fossil record has many gaps, however, precise divergence timesbetween species are difficult to establish, even for species that leave good fossilswith distinctive morphology.Phylogenetic trees whose timing has been calibrated according to the fossil record suggest that changes in the sequences of particular genes or proteinstend to occur at a nearly constant rate, although rates that differ from the normby as much as twofold are observed in particular lineages. This provides us with amolecular clock for evolution—or rather a set of molecular clocks correspondingto different categories of DNA sequence.

As in the example in Figure 4–65, theclock runs most rapidly and regularly in sequences that are not subject to purifyingselection. These include portions of introns that lack splicing or regulatory signals,the third position in synonymous codons, and genes that have been irreversiblyinactivated by mutation (the so-called pseudogenes). The clock runs most slowlyfor sequences that are subject to strong functional constraints—for example, theamino acid sequences of proteins that engage in specific interactions with largenumbers of other proteins and whose structure is therefore highly constrained,or the nucleotide sequences that encode the RNA subunits of the ribosome, onwhich all protein synthesis depends.Occasionally, rapid change is seen in a previously highly conserved sequence.As discussed later in this chapter, such episodes are especially interesting becausethey are thought to reflect periods of strong positive selection for mutations thathave conferred a selective advantage in the particular lineage where the rapidchange occurred.The pace at which molecular clocks run during evolution is determined notonly by the degree of purifying selection, but also by the mutation rate.

Mostnotably, in animals, although not in plants, clocks based on functionally unconstrained mitochondrial DNA sequences run much faster than clocks based onfunctionally unconstrained nuclear sequences, because the mutation rate in animal mitochondria is exceptionally high.Categories of DNA for which the clock runs fast are most informative for recentevolutionary events; the mitochondrial DNA clock has been used, for example, tochronicle the divergence of the Neanderthal lineage from that of modern Homosapiens. To study more ancient evolutionary events, one must examine DNA forwhich the clock runs more slowly; thus the divergence of the major branches ofthe tree of life—bacteria, archaea, and eukaryotes—has been deduced from studyof the sequences specifying ribosomal RNA.In general, molecular clocks, appropriately chosen, have a finer time resolution than the fossil record, and they are a more reliable guide to the detailed structure of phylogenetic trees than are classical methods of tree construction, whichare based on family resemblances in anatomy and embryonic development.

Forexample, the precise family tree of great apes and humans was not settled untilsufficient molecular sequence data accumulated in the 1980s to produce the pedigree shown previously in Figure 4–63. And with huge amounts of DNA sequencenow determined from a wide variety of mammals, much better estimates of ourrelationship to them are being obtained (Figure 4–66).HOW GENOMES EVOLVE221opossumarmadilloancestorbatcathorsewallabyhedgehogdogcowsheepIndian muntjacpigrabbitgalagoratmouselemurmarmosetsquirrel monkeyvervetbaboonmacaqueorangutangorillachimpanzeehumanA Comparison of Human and Mouse Chromosomes Shows Howthe Structures of Genomes DivergeAs would be expected, the human and chimpanzee genomes are much morealike than are the human and mousegenomes,even though all three genomesMBoC6m4.77/4.64are roughly the same size and contain nearly identical sets of genes.

Mouse andhuman lineages have had approximately 80 million years to diverge through accumulated mutations, versus 6 million years for humans and chimpanzees. In addition, as indicated in Figure 4–66, rodent lineages (represented by the rat and themouse) have unusually fast molecular clocks, and have diverged from the humanlineage more rapidly than otherwise expected.While the way that the genome is organized into chromosomes is almost identical between humans and chimpanzees, this organization has diverged greatlybetween humans and mice.

According to rough estimates, a total of about 180breakage-and-rejoining events have occurred in the human and mouse lineagessince these two species last shared a common ancestor. In the process, althoughthe number of chromosomes is similar in the two species (23 per haploid genomein the human versus 20 in the mouse), their overall structures differ greatly. Nonetheless, even after the extensive genomic shuffling, there are many large blocksof DNA in which the gene order is the same in the human and the mouse. Thesestretches of conserved gene order in chromosomes are referred to as regions ofsynteny.

Характеристики

Тип файла
PDF-файл
Размер
102,35 Mb
Тип материала
Предмет
Высшее учебное заведение

Список файлов книги

Свежие статьи
Популярно сейчас
А знаете ли Вы, что из года в год задания практически не меняются? Математика, преподаваемая в учебных заведениях, никак не менялась минимум 30 лет. Найдите нужный учебный материал на СтудИзбе!
Ответы на популярные вопросы
Да! Наши авторы собирают и выкладывают те работы, которые сдаются в Вашем учебном заведении ежегодно и уже проверены преподавателями.
Да! У нас любой человек может выложить любую учебную работу и зарабатывать на её продажах! Но каждый учебный материал публикуется только после тщательной проверки администрацией.
Вернём деньги! А если быть более точными, то автору даётся немного времени на исправление, а если не исправит или выйдет время, то вернём деньги в полном объёме!
Да! На равне с готовыми студенческими работами у нас продаются услуги. Цены на услуги видны сразу, то есть Вам нужно только указать параметры и сразу можно оплачивать.
Отзывы студентов
Ставлю 10/10
Все нравится, очень удобный сайт, помогает в учебе. Кроме этого, можно заработать самому, выставляя готовые учебные материалы на продажу здесь. Рейтинги и отзывы на преподавателей очень помогают сориентироваться в начале нового семестра. Спасибо за такую функцию. Ставлю максимальную оценку.
Лучшая платформа для успешной сдачи сессии
Познакомился со СтудИзбой благодаря своему другу, очень нравится интерфейс, количество доступных файлов, цена, в общем, все прекрасно. Даже сам продаю какие-то свои работы.
Студизба ван лав ❤
Очень офигенный сайт для студентов. Много полезных учебных материалов. Пользуюсь студизбой с октября 2021 года. Серьёзных нареканий нет. Хотелось бы, что бы ввели подписочную модель и сделали материалы дешевле 300 рублей в рамках подписки бесплатными.
Отличный сайт
Лично меня всё устраивает - и покупка, и продажа; и цены, и возможность предпросмотра куска файла, и обилие бесплатных файлов (в подборках по авторам, читай, ВУЗам и факультетам). Есть определённые баги, но всё решаемо, да и администраторы реагируют в течение суток.
Маленький отзыв о большом помощнике!
Студизба спасает в те моменты, когда сроки горят, а работ накопилось достаточно. Довольно удобный сайт с простой навигацией и огромным количеством материалов.
Студ. Изба как крупнейший сборник работ для студентов
Тут дофига бывает всего полезного. Печально, что бывают предметы по которым даже одного бесплатного решения нет, но это скорее вопрос к студентам. В остальном всё здорово.
Спасательный островок
Если уже не успеваешь разобраться или застрял на каком-то задание поможет тебе быстро и недорого решить твою проблему.
Всё и так отлично
Всё очень удобно. Особенно круто, что есть система бонусов и можно выводить остатки денег. Очень много качественных бесплатных файлов.
Отзыв о системе "Студизба"
Отличная платформа для распространения работ, востребованных студентами. Хорошо налаженная и качественная работа сайта, огромная база заданий и аудитория.
Отличный помощник
Отличный сайт с кучей полезных файлов, позволяющий найти много методичек / учебников / отзывов о вузах и преподователях.
Отлично помогает студентам в любой момент для решения трудных и незамедлительных задач
Хотелось бы больше конкретной информации о преподавателях. А так в принципе хороший сайт, всегда им пользуюсь и ни разу не было желания прекратить. Хороший сайт для помощи студентам, удобный и приятный интерфейс. Из недостатков можно выделить только отсутствия небольшого количества файлов.
Спасибо за шикарный сайт
Великолепный сайт на котором студент за не большие деньги может найти помощь с дз, проектами курсовыми, лабораторными, а также узнать отзывы на преподавателей и бесплатно скачать пособия.
Популярные преподаватели
Добавляйте материалы
и зарабатывайте!
Продажи идут автоматически
7248
Авторов
на СтудИзбе
247
Средний доход
с одного платного файла
Обучение Подробнее