Главная » Просмотр файлов » B. Alberts, A. Johnson, J. Lewis и др. - Molecular Biology of The Cell (6th edition)

B. Alberts, A. Johnson, J. Lewis и др. - Molecular Biology of The Cell (6th edition) (1120996), страница 9

Файл №1120996 B. Alberts, A. Johnson, J. Lewis и др. - Molecular Biology of The Cell (6th edition) (B. Alberts, A. Johnson, J. Lewis и др. - Molecular Biology of The Cell (6th edition)) 9 страницаB. Alberts, A. Johnson, J. Lewis и др. - Molecular Biology of The Cell (6th edition) (1120996) страница 92019-05-09СтудИзба
Просмтор этого файла доступен только зарегистрированным пользователям. Но у нас супер быстрая регистрация: достаточно только электронной почты!

Текст из файла (страница 9)

This base-pairing holds fresh monomers in place and thereby controls the selection of which one of the four monomers shall be added to the growing strand next. In this way, aMBoC6double-strandedstructure is created, consisting ofm1.03/1.03two exactly complementary sequences of As, Cs, Ts, and Gs.

The two strands twistaround each other, forming a DNA double helix (Figure 1–2E).The bonds between the base pairs are weak compared with the sugar-phosphate links, and this allows the two DNA strands to be pulled apart without breakage of their backbones. Each strand then can serve as a template, in the way justdescribed, for the synthesis of a fresh DNA strand complementary to itself—afresh copy, that is, of the hereditary information (Figure 1–3). In different typesof cells, this process of DNA replication occurs at different rates, with differentcontrols to start it or stop it, and different auxiliary molecules to help it along. Butthe basics are universal: DNA is the information store for heredity, and templatedpolymerization is the way in which this information is copied throughout the living world.All Cells Transcribe Portions of Their Hereditary Information intothe Same Intermediary Form: RNATo carry out its information-bearing function, DNA must do more than copy itself.It must also express its information, by letting the information guide the synthesisof other molecules in the cell.

This expression occurs by a mechanism that is thesame in all living organisms, leading first and foremost to the production of twoother key classes of polymers: RNAs and proteins. The process (discussed in detailin Chapters 6 and 7) begins with a templated polymerization called transcription,in which segments of the DNA sequence are used as templates for the synthesis of shorter molecules of the closely related polymer ribonucleic acid, or RNA.Later, in the more complex process of translation, many of these RNA moleculesdirect the synthesis of polymers of a radically different chemical class—the proteins (Figure 1–4).In RNA, the backbone is formed of a slightly different sugar from that of DNA—ribose instead of deoxyribose—and one of the four bases is slightly different—uracil (U) in place of thymine (T). But the other three bases—A, C, and G—are thesame, and all four bases pair with their complementary counterparts in DNA—theA, U, C, and G of RNA with the T, A, G, and C of DNA.

During transcription, theRNA monomers are lined up and selected for polymerization on a template strandof DNA, just as DNA monomers are selected during replication. The outcome is apolymer molecule whose sequence of nucleotides faithfully represents a portionof the cell’s genetic information, even though it is written in a slightly differentalphabet—consisting of RNA monomers instead of DNA monomers.The same segment of DNA can be used repeatedly to guide the synthesis ofmany identical RNA molecules. Thus, whereas the cell’s archive of genetic information in the form of DNA is fixed and sacrosanct, these RNA transcripts areDNADNA synthesisREPLICATIONnucleotidesDNARNA synthesisTRANSCRIPTIONRNAprotein synthesisTRANSLATIONPROTEINamino acidsFigure 1–4 From DNA to protein.Genetic information is read out and putto use through a two-step process.

First,in transcription, segments of the DNAsequence are used to guide the synthesisof molecules of RNA. Then, in translation,the RNA molecules are used to guide theMBoC6e1.02/1.04synthesisof moleculesof protein.THE UNIVERSAL FEATURES OF CELLS ON EARTH5RNA MOLECULES AS EXPENDABLEINFORMATION CARRIERSDOUBLE-STRANDED DNA ASINFORMATION ARCHIVETRANSCRIPTIONstrand used as a template todirect RNA synthesismany identicalRNA transcriptsFigure 1–5 How genetic informationis broadcast for use inside the cell.Each cell contains a fixed set of DNAmolecules—its archive of geneticinformation.

A given segment of this DNAguides the synthesis of many identical RNAtranscripts, which serve as working copiesof the information stored in the archive.Many different sets of RNA molecules canbe made by transcribing different parts ofa cell’s DNA sequences, allowing differenttypes of cells to use the same informationstore differently.mass-produced and disposable (Figure 1–5). As we shall see, these transcriptsfunction as intermediates in the transfer of genetic information. Most notably,they serve as messenger RNA (mRNA) molecules that guide the synthesis of proteins according to the genetic instructions stored in the DNA.RNA molecules have distinctive structures that can also give them other specialized chemical capabilities.

Being single-stranded, their backbone is flexible,so that the polymer chain can bend back on itself to allow one part of the moleculeto form weak bonds with another part of the same molecule. This occurs whenMBoC6m1.05/1.05segments of the sequenceare locallycomplementary: a ...GGGG... segment, forexample, will tend to associate with a ...CCCC... segment. These types of internalassociations can cause an RNA chain to fold up into a specific shape that is dictated by its sequence (Figure 1–6). The shape of the RNA molecule, in turn, mayenable it to recognize other molecules by binding to them selectively—and even,in certain cases, to catalyze chemical changes in the molecules that are bound. Infact, some chemical reactions catalyzed by RNA molecules are crucial for severalof the most ancient and fundamental processes in living cells, and it has been suggested that an extensive catalysis by RNA played a central part in the early evolution of life (discussed in Chapter 6).All Cells Use Proteins as CatalystsProtein molecules, like DNA and RNA molecules, are long unbranched polymerchains, formed by stringing together monomeric building blocks drawn from astandard repertoire that is the same for all living cells.

Like DNA and RNA, proteins carry information in the form of a linear sequence of symbols, in the sameway as a human message written in an alphabetic script. There are many differentprotein molecules in each cell, and—leaving out the water—they form most of thecell’s mass.GUAUGCCAGUUAGCCGCAUACCC UG GG(A)AAGCUUAAAUCGAAUUUAUGCAUUACGUAAAAUUU(B)Figure 1–6 The conformation of anRNA molecule. (A) Nucleotide pairingbetween different regions of the sameRNA polymer chain causes the moleculeto adopt a distinctive shape.

(B) Thethree-dimensional structure of an actualRNA molecule produced by hepatitis deltavirus; this RNA can catalyze RNA strandcleavage. The blue ribbon represents thesugar-phosphate backbone and the barsrepresent base pairs (see Movie 6.1).(B, based on A.R. Ferré-D’Amaré, K. Zhou,and J.A. Doudna, Nature 395:567–574,1998. With permission from MacmillanPublishers Ltd.)6Chapter 1: Cells and Genomespolysaccharidechain++catalytic sitelysozymemolecule(B)(A) lysozymeFigure 1–7 How a protein molecule acts as a catalyst for a chemical reaction. (A) In a proteinmolecule, the polymer chain folds up into a specific shape defined by its amino acid sequence.

Agroove in the surface of this particular folded molecule, the enzyme lysozyme, forms a catalytic site.(B) A polysaccharide molecule (red)—a polymer chain of sugar monomers—binds to the catalytic site oflysozyme and is broken apart, as a result of a covalent bond-breaking reaction catalyzed by the aminoacids lining the groove (see Movie 3.9). (PDB code: 1LYD.)The monomers of protein, the amino acids, are quite different from those ofDNA and RNA, and there are 20 types instead of 4.

Each amino acid is built aroundthe same core structure through which it can be linked in a standard way to anyother amino acid in the set; attached to this core is a side group that gives eachamino acid a distinctive chemical character. Each of the protein molecules is apolypeptide, created by joining its amino acids in a particular sequence. Throughbillions of years of evolution, this sequence has been selected to give the protein auseful function.

Thus, by folding intoa precisethree-dimensional form with reacMBoC6m1.07/1.07tive sites on its surface (Figure 1–7A), these amino-acid polymers can bind withhigh specificity to other molecules and can act as enzymes to catalyze reactionsthat make or break covalent bonds. In this way they direct the vast majority ofchemical processes in the cell (Figure 1–7B).Proteins have many other functions as well—maintaining structures, generating movements, sensing signals, and so on—each protein molecule performinga specific function according to its own genetically specified sequence of aminoacids.

Proteins, above all, are the main molecules that put the cell’s genetic information into action.Thus, polynucleotides specify the amino acid sequences of proteins. Proteins,in turn, catalyze many chemical reactions, including those by which new DNAmolecules are synthesized. From the most fundamental point of view, a living cellis a self-replicating collection of catalysts that takes in food, processes this foodto derive both the building blocks and energy needed to make more catalysts,and discards the materials left over as waste (Figure 1–8A). A feedback loop thatconnects proteins and polynucleotides forms the basis for this autocatalytic, selfreproducing behavior of living organisms (Figure 1–8B).All Cells Translate RNA into Protein in the Same WayHow the information in DNA specifies the production of proteins was a complete mystery in the 1950s when the double-stranded structure of DNA was firstrevealed as the basis of heredity. But in the intervening years, scientists have discovered the elegant mechanisms involved.

Характеристики

Тип файла
PDF-файл
Размер
102,35 Mb
Тип материала
Предмет
Высшее учебное заведение

Список файлов книги

Свежие статьи
Популярно сейчас
Как Вы думаете, сколько людей до Вас делали точно такое же задание? 99% студентов выполняют точно такие же задания, как и их предшественники год назад. Найдите нужный учебный материал на СтудИзбе!
Ответы на популярные вопросы
Да! Наши авторы собирают и выкладывают те работы, которые сдаются в Вашем учебном заведении ежегодно и уже проверены преподавателями.
Да! У нас любой человек может выложить любую учебную работу и зарабатывать на её продажах! Но каждый учебный материал публикуется только после тщательной проверки администрацией.
Вернём деньги! А если быть более точными, то автору даётся немного времени на исправление, а если не исправит или выйдет время, то вернём деньги в полном объёме!
Да! На равне с готовыми студенческими работами у нас продаются услуги. Цены на услуги видны сразу, то есть Вам нужно только указать параметры и сразу можно оплачивать.
Отзывы студентов
Ставлю 10/10
Все нравится, очень удобный сайт, помогает в учебе. Кроме этого, можно заработать самому, выставляя готовые учебные материалы на продажу здесь. Рейтинги и отзывы на преподавателей очень помогают сориентироваться в начале нового семестра. Спасибо за такую функцию. Ставлю максимальную оценку.
Лучшая платформа для успешной сдачи сессии
Познакомился со СтудИзбой благодаря своему другу, очень нравится интерфейс, количество доступных файлов, цена, в общем, все прекрасно. Даже сам продаю какие-то свои работы.
Студизба ван лав ❤
Очень офигенный сайт для студентов. Много полезных учебных материалов. Пользуюсь студизбой с октября 2021 года. Серьёзных нареканий нет. Хотелось бы, что бы ввели подписочную модель и сделали материалы дешевле 300 рублей в рамках подписки бесплатными.
Отличный сайт
Лично меня всё устраивает - и покупка, и продажа; и цены, и возможность предпросмотра куска файла, и обилие бесплатных файлов (в подборках по авторам, читай, ВУЗам и факультетам). Есть определённые баги, но всё решаемо, да и администраторы реагируют в течение суток.
Маленький отзыв о большом помощнике!
Студизба спасает в те моменты, когда сроки горят, а работ накопилось достаточно. Довольно удобный сайт с простой навигацией и огромным количеством материалов.
Студ. Изба как крупнейший сборник работ для студентов
Тут дофига бывает всего полезного. Печально, что бывают предметы по которым даже одного бесплатного решения нет, но это скорее вопрос к студентам. В остальном всё здорово.
Спасательный островок
Если уже не успеваешь разобраться или застрял на каком-то задание поможет тебе быстро и недорого решить твою проблему.
Всё и так отлично
Всё очень удобно. Особенно круто, что есть система бонусов и можно выводить остатки денег. Очень много качественных бесплатных файлов.
Отзыв о системе "Студизба"
Отличная платформа для распространения работ, востребованных студентами. Хорошо налаженная и качественная работа сайта, огромная база заданий и аудитория.
Отличный помощник
Отличный сайт с кучей полезных файлов, позволяющий найти много методичек / учебников / отзывов о вузах и преподователях.
Отлично помогает студентам в любой момент для решения трудных и незамедлительных задач
Хотелось бы больше конкретной информации о преподавателях. А так в принципе хороший сайт, всегда им пользуюсь и ни разу не было желания прекратить. Хороший сайт для помощи студентам, удобный и приятный интерфейс. Из недостатков можно выделить только отсутствия небольшого количества файлов.
Спасибо за шикарный сайт
Великолепный сайт на котором студент за не большие деньги может найти помощь с дз, проектами курсовыми, лабораторными, а также узнать отзывы на преподавателей и бесплатно скачать пособия.
Популярные преподаватели
Добавляйте материалы
и зарабатывайте!
Продажи идут автоматически
7264
Авторов
на СтудИзбе
245
Средний доход
с одного платного файла
Обучение Подробнее